ID: 952101276

View in Genome Browser
Species Human (GRCh38)
Location 3:30016183-30016205
Sequence TCATTTTAGTTGGTGGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952101276_952101284 19 Left 952101276 3:30016183-30016205 CCCACGCCCACCAACTAAAATGA No data
Right 952101284 3:30016225-30016247 TTATAATTTTAAATTGCTTAGGG No data
952101276_952101283 18 Left 952101276 3:30016183-30016205 CCCACGCCCACCAACTAAAATGA No data
Right 952101283 3:30016224-30016246 ATTATAATTTTAAATTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952101276 Original CRISPR TCATTTTAGTTGGTGGGCGT GGG (reversed) Intergenic
No off target data available for this crispr