ID: 952101277

View in Genome Browser
Species Human (GRCh38)
Location 3:30016184-30016206
Sequence GTCATTTTAGTTGGTGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952101277_952101284 18 Left 952101277 3:30016184-30016206 CCACGCCCACCAACTAAAATGAC No data
Right 952101284 3:30016225-30016247 TTATAATTTTAAATTGCTTAGGG No data
952101277_952101283 17 Left 952101277 3:30016184-30016206 CCACGCCCACCAACTAAAATGAC No data
Right 952101283 3:30016224-30016246 ATTATAATTTTAAATTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952101277 Original CRISPR GTCATTTTAGTTGGTGGGCG TGG (reversed) Intergenic
No off target data available for this crispr