ID: 952101278 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:30016189-30016211 |
| Sequence | GAGTTGTCATTTTAGTTGGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 952101278_952101284 | 13 | Left | 952101278 | 3:30016189-30016211 | CCCACCAACTAAAATGACAACTC | No data | ||
| Right | 952101284 | 3:30016225-30016247 | TTATAATTTTAAATTGCTTAGGG | No data | ||||
| 952101278_952101283 | 12 | Left | 952101278 | 3:30016189-30016211 | CCCACCAACTAAAATGACAACTC | No data | ||
| Right | 952101283 | 3:30016224-30016246 | ATTATAATTTTAAATTGCTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 952101278 | Original CRISPR | GAGTTGTCATTTTAGTTGGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||