ID: 952101278

View in Genome Browser
Species Human (GRCh38)
Location 3:30016189-30016211
Sequence GAGTTGTCATTTTAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952101278_952101284 13 Left 952101278 3:30016189-30016211 CCCACCAACTAAAATGACAACTC No data
Right 952101284 3:30016225-30016247 TTATAATTTTAAATTGCTTAGGG No data
952101278_952101283 12 Left 952101278 3:30016189-30016211 CCCACCAACTAAAATGACAACTC No data
Right 952101283 3:30016224-30016246 ATTATAATTTTAAATTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952101278 Original CRISPR GAGTTGTCATTTTAGTTGGT GGG (reversed) Intergenic
No off target data available for this crispr