ID: 952101279

View in Genome Browser
Species Human (GRCh38)
Location 3:30016190-30016212
Sequence GGAGTTGTCATTTTAGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952101279_952101283 11 Left 952101279 3:30016190-30016212 CCACCAACTAAAATGACAACTCC No data
Right 952101283 3:30016224-30016246 ATTATAATTTTAAATTGCTTAGG No data
952101279_952101284 12 Left 952101279 3:30016190-30016212 CCACCAACTAAAATGACAACTCC No data
Right 952101284 3:30016225-30016247 TTATAATTTTAAATTGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952101279 Original CRISPR GGAGTTGTCATTTTAGTTGG TGG (reversed) Intergenic
No off target data available for this crispr