ID: 952101282

View in Genome Browser
Species Human (GRCh38)
Location 3:30016211-30016233
Sequence AAATTATAATCAGAAGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952101282_952101283 -10 Left 952101282 3:30016211-30016233 CCTTTGGCTTCTGATTATAATTT No data
Right 952101283 3:30016224-30016246 ATTATAATTTTAAATTGCTTAGG No data
952101282_952101284 -9 Left 952101282 3:30016211-30016233 CCTTTGGCTTCTGATTATAATTT No data
Right 952101284 3:30016225-30016247 TTATAATTTTAAATTGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952101282 Original CRISPR AAATTATAATCAGAAGCCAA AGG (reversed) Intergenic
No off target data available for this crispr