ID: 952101283

View in Genome Browser
Species Human (GRCh38)
Location 3:30016224-30016246
Sequence ATTATAATTTTAAATTGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952101280_952101283 8 Left 952101280 3:30016193-30016215 CCAACTAAAATGACAACTCCTTT No data
Right 952101283 3:30016224-30016246 ATTATAATTTTAAATTGCTTAGG No data
952101279_952101283 11 Left 952101279 3:30016190-30016212 CCACCAACTAAAATGACAACTCC No data
Right 952101283 3:30016224-30016246 ATTATAATTTTAAATTGCTTAGG No data
952101278_952101283 12 Left 952101278 3:30016189-30016211 CCCACCAACTAAAATGACAACTC No data
Right 952101283 3:30016224-30016246 ATTATAATTTTAAATTGCTTAGG No data
952101282_952101283 -10 Left 952101282 3:30016211-30016233 CCTTTGGCTTCTGATTATAATTT No data
Right 952101283 3:30016224-30016246 ATTATAATTTTAAATTGCTTAGG No data
952101276_952101283 18 Left 952101276 3:30016183-30016205 CCCACGCCCACCAACTAAAATGA No data
Right 952101283 3:30016224-30016246 ATTATAATTTTAAATTGCTTAGG No data
952101277_952101283 17 Left 952101277 3:30016184-30016206 CCACGCCCACCAACTAAAATGAC No data
Right 952101283 3:30016224-30016246 ATTATAATTTTAAATTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952101283 Original CRISPR ATTATAATTTTAAATTGCTT AGG Intergenic
No off target data available for this crispr