ID: 952102668

View in Genome Browser
Species Human (GRCh38)
Location 3:30032950-30032972
Sequence CTGAGGGGATGGAGGTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952102661_952102668 1 Left 952102661 3:30032926-30032948 CCACAGTGGACATCAGAGATGAA No data
Right 952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952102668 Original CRISPR CTGAGGGGATGGAGGTAAGA GGG Intergenic
No off target data available for this crispr