ID: 952103584

View in Genome Browser
Species Human (GRCh38)
Location 3:30043419-30043441
Sequence GCTGCTGGGGAGACACAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952103580_952103584 4 Left 952103580 3:30043392-30043414 CCTGTGGTCAGGGATGTCTGCAC No data
Right 952103584 3:30043419-30043441 GCTGCTGGGGAGACACAATTAGG No data
952103579_952103584 9 Left 952103579 3:30043387-30043409 CCTAGCCTGTGGTCAGGGATGTC No data
Right 952103584 3:30043419-30043441 GCTGCTGGGGAGACACAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952103584 Original CRISPR GCTGCTGGGGAGACACAATT AGG Intergenic
No off target data available for this crispr