ID: 952107110

View in Genome Browser
Species Human (GRCh38)
Location 3:30083634-30083656
Sequence TCCTTCTGGTGAGGCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952107110_952107114 -1 Left 952107110 3:30083634-30083656 CCAGCACTGCCTCACCAGAAGGA No data
Right 952107114 3:30083656-30083678 AACTGGAGAAACAATTCTATAGG No data
952107110_952107117 28 Left 952107110 3:30083634-30083656 CCAGCACTGCCTCACCAGAAGGA No data
Right 952107117 3:30083685-30083707 CCAAGTTTTTGTATGCCCTTAGG No data
952107110_952107115 0 Left 952107110 3:30083634-30083656 CCAGCACTGCCTCACCAGAAGGA No data
Right 952107115 3:30083657-30083679 ACTGGAGAAACAATTCTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952107110 Original CRISPR TCCTTCTGGTGAGGCAGTGC TGG (reversed) Intergenic
No off target data available for this crispr