ID: 952108313

View in Genome Browser
Species Human (GRCh38)
Location 3:30093721-30093743
Sequence GTAAGGGAAATAAATCAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952108313_952108320 24 Left 952108313 3:30093721-30093743 CCATATTGATTTATTTCCCTTAC No data
Right 952108320 3:30093768-30093790 TTTCCACTGTGGGCATGTTTAGG No data
952108313_952108317 -2 Left 952108313 3:30093721-30093743 CCATATTGATTTATTTCCCTTAC No data
Right 952108317 3:30093742-30093764 ACTGTGCATGAATTAAGGAACGG No data
952108313_952108318 13 Left 952108313 3:30093721-30093743 CCATATTGATTTATTTCCCTTAC No data
Right 952108318 3:30093757-30093779 AGGAACGGAATTTTCCACTGTGG No data
952108313_952108319 14 Left 952108313 3:30093721-30093743 CCATATTGATTTATTTCCCTTAC No data
Right 952108319 3:30093758-30093780 GGAACGGAATTTTCCACTGTGGG No data
952108313_952108315 -7 Left 952108313 3:30093721-30093743 CCATATTGATTTATTTCCCTTAC No data
Right 952108315 3:30093737-30093759 CCCTTACTGTGCATGAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952108313 Original CRISPR GTAAGGGAAATAAATCAATA TGG (reversed) Intergenic