ID: 952108316

View in Genome Browser
Species Human (GRCh38)
Location 3:30093738-30093760
Sequence TCCTTAATTCATGCACAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952108316_952108320 7 Left 952108316 3:30093738-30093760 CCTTACTGTGCATGAATTAAGGA No data
Right 952108320 3:30093768-30093790 TTTCCACTGTGGGCATGTTTAGG No data
952108316_952108319 -3 Left 952108316 3:30093738-30093760 CCTTACTGTGCATGAATTAAGGA No data
Right 952108319 3:30093758-30093780 GGAACGGAATTTTCCACTGTGGG No data
952108316_952108318 -4 Left 952108316 3:30093738-30093760 CCTTACTGTGCATGAATTAAGGA No data
Right 952108318 3:30093757-30093779 AGGAACGGAATTTTCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952108316 Original CRISPR TCCTTAATTCATGCACAGTA AGG (reversed) Intergenic