ID: 952108319

View in Genome Browser
Species Human (GRCh38)
Location 3:30093758-30093780
Sequence GGAACGGAATTTTCCACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952108314_952108319 -2 Left 952108314 3:30093737-30093759 CCCTTACTGTGCATGAATTAAGG No data
Right 952108319 3:30093758-30093780 GGAACGGAATTTTCCACTGTGGG No data
952108316_952108319 -3 Left 952108316 3:30093738-30093760 CCTTACTGTGCATGAATTAAGGA No data
Right 952108319 3:30093758-30093780 GGAACGGAATTTTCCACTGTGGG No data
952108313_952108319 14 Left 952108313 3:30093721-30093743 CCATATTGATTTATTTCCCTTAC No data
Right 952108319 3:30093758-30093780 GGAACGGAATTTTCCACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952108319 Original CRISPR GGAACGGAATTTTCCACTGT GGG Intergenic