ID: 952110387

View in Genome Browser
Species Human (GRCh38)
Location 3:30116678-30116700
Sequence CATTGTAAGATATATATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952110385_952110387 -7 Left 952110385 3:30116662-30116684 CCTAGACAGACAAGATCATTGTA No data
Right 952110387 3:30116678-30116700 CATTGTAAGATATATATGGAAGG No data
952110384_952110387 10 Left 952110384 3:30116645-30116667 CCAGCAAGACTTTTTTTCCTAGA No data
Right 952110387 3:30116678-30116700 CATTGTAAGATATATATGGAAGG No data
952110383_952110387 11 Left 952110383 3:30116644-30116666 CCCAGCAAGACTTTTTTTCCTAG No data
Right 952110387 3:30116678-30116700 CATTGTAAGATATATATGGAAGG No data
952110382_952110387 22 Left 952110382 3:30116633-30116655 CCTCTCAAAATCCCAGCAAGACT No data
Right 952110387 3:30116678-30116700 CATTGTAAGATATATATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952110387 Original CRISPR CATTGTAAGATATATATGGA AGG Intergenic
No off target data available for this crispr