ID: 952121354

View in Genome Browser
Species Human (GRCh38)
Location 3:30248708-30248730
Sequence TAGGAGAAGAAGAATGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952121354_952121361 8 Left 952121354 3:30248708-30248730 CCTATCTCATTCTTCTTCTCCTA No data
Right 952121361 3:30248739-30248761 GAGGGGATGAGAAAGGAAAGTGG No data
952121354_952121357 -9 Left 952121354 3:30248708-30248730 CCTATCTCATTCTTCTTCTCCTA No data
Right 952121357 3:30248722-30248744 CTTCTCCTACCACTTGTGAGGGG No data
952121354_952121356 -10 Left 952121354 3:30248708-30248730 CCTATCTCATTCTTCTTCTCCTA No data
Right 952121356 3:30248721-30248743 TCTTCTCCTACCACTTGTGAGGG No data
952121354_952121360 1 Left 952121354 3:30248708-30248730 CCTATCTCATTCTTCTTCTCCTA No data
Right 952121360 3:30248732-30248754 CACTTGTGAGGGGATGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952121354 Original CRISPR TAGGAGAAGAAGAATGAGAT AGG (reversed) Intergenic
No off target data available for this crispr