ID: 952122804

View in Genome Browser
Species Human (GRCh38)
Location 3:30264620-30264642
Sequence CTGTGTCAGAGGAAAGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952122804_952122810 15 Left 952122804 3:30264620-30264642 CCCAGATCTTTCCTCTGACACAG No data
Right 952122810 3:30264658-30264680 AGGAACCAGAAAAACAATTCTGG 0: 163
1: 257
2: 480
3: 621
4: 915
952122804_952122807 -5 Left 952122804 3:30264620-30264642 CCCAGATCTTTCCTCTGACACAG No data
Right 952122807 3:30264638-30264660 CACAGTCTACCCAAATGAGAAGG 0: 15
1: 173
2: 567
3: 455
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952122804 Original CRISPR CTGTGTCAGAGGAAAGATCT GGG (reversed) Intergenic
No off target data available for this crispr