ID: 952124589

View in Genome Browser
Species Human (GRCh38)
Location 3:30285577-30285599
Sequence GCAAGTATTCAGTTGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952124587_952124589 11 Left 952124587 3:30285543-30285565 CCAAACTTAAAGATGGGTTCTGG No data
Right 952124589 3:30285577-30285599 GCAAGTATTCAGTTGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952124589 Original CRISPR GCAAGTATTCAGTTGAAAGA AGG Intergenic
No off target data available for this crispr