ID: 952125328

View in Genome Browser
Species Human (GRCh38)
Location 3:30293016-30293038
Sequence TTCCCACAGCACAAAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952125324_952125328 15 Left 952125324 3:30292978-30293000 CCTGGAAAGCATGGACAATATTT No data
Right 952125328 3:30293016-30293038 TTCCCACAGCACAAAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952125328 Original CRISPR TTCCCACAGCACAAAGGGCT GGG Intergenic
No off target data available for this crispr