ID: 952127974

View in Genome Browser
Species Human (GRCh38)
Location 3:30324432-30324454
Sequence CTAAGATTCTCAGAGGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952127968_952127974 28 Left 952127968 3:30324381-30324403 CCCCAAACTAGAGATTTAGCCAA No data
Right 952127974 3:30324432-30324454 CTAAGATTCTCAGAGGTAGCAGG No data
952127969_952127974 27 Left 952127969 3:30324382-30324404 CCCAAACTAGAGATTTAGCCAAA No data
Right 952127974 3:30324432-30324454 CTAAGATTCTCAGAGGTAGCAGG No data
952127972_952127974 9 Left 952127972 3:30324400-30324422 CCAAAGAAAAGGTGAAAATGAAT No data
Right 952127974 3:30324432-30324454 CTAAGATTCTCAGAGGTAGCAGG No data
952127970_952127974 26 Left 952127970 3:30324383-30324405 CCAAACTAGAGATTTAGCCAAAG No data
Right 952127974 3:30324432-30324454 CTAAGATTCTCAGAGGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952127974 Original CRISPR CTAAGATTCTCAGAGGTAGC AGG Intergenic
No off target data available for this crispr