ID: 952128022

View in Genome Browser
Species Human (GRCh38)
Location 3:30324889-30324911
Sequence CTCTCTGGGCAGAGGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952128013_952128022 14 Left 952128013 3:30324852-30324874 CCCACCAGTGAGATGTTGGTAAA No data
Right 952128022 3:30324889-30324911 CTCTCTGGGCAGAGGTAGGGAGG No data
952128011_952128022 18 Left 952128011 3:30324848-30324870 CCTTCCCACCAGTGAGATGTTGG No data
Right 952128022 3:30324889-30324911 CTCTCTGGGCAGAGGTAGGGAGG No data
952128008_952128022 29 Left 952128008 3:30324837-30324859 CCCCATGCAGTCCTTCCCACCAG No data
Right 952128022 3:30324889-30324911 CTCTCTGGGCAGAGGTAGGGAGG No data
952128010_952128022 27 Left 952128010 3:30324839-30324861 CCATGCAGTCCTTCCCACCAGTG No data
Right 952128022 3:30324889-30324911 CTCTCTGGGCAGAGGTAGGGAGG No data
952128009_952128022 28 Left 952128009 3:30324838-30324860 CCCATGCAGTCCTTCCCACCAGT No data
Right 952128022 3:30324889-30324911 CTCTCTGGGCAGAGGTAGGGAGG No data
952128015_952128022 10 Left 952128015 3:30324856-30324878 CCAGTGAGATGTTGGTAAATGTT No data
Right 952128022 3:30324889-30324911 CTCTCTGGGCAGAGGTAGGGAGG No data
952128014_952128022 13 Left 952128014 3:30324853-30324875 CCACCAGTGAGATGTTGGTAAAT No data
Right 952128022 3:30324889-30324911 CTCTCTGGGCAGAGGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952128022 Original CRISPR CTCTCTGGGCAGAGGTAGGG AGG Intergenic
No off target data available for this crispr