ID: 952128677

View in Genome Browser
Species Human (GRCh38)
Location 3:30333799-30333821
Sequence GCTCTTAGAGATACGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952128677_952128681 7 Left 952128677 3:30333799-30333821 CCCCAGCACGTATCTCTAAGAGC No data
Right 952128681 3:30333829-30333851 TAATTGCTTTGTTGCAATCGTGG No data
952128677_952128682 22 Left 952128677 3:30333799-30333821 CCCCAGCACGTATCTCTAAGAGC No data
Right 952128682 3:30333844-30333866 AATCGTGGTGATAGAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952128677 Original CRISPR GCTCTTAGAGATACGTGCTG GGG (reversed) Intergenic
No off target data available for this crispr