ID: 952131576

View in Genome Browser
Species Human (GRCh38)
Location 3:30370293-30370315
Sequence CCATGGTCCCAACTGTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952131576_952131580 -4 Left 952131576 3:30370293-30370315 CCTGGCAACAGTTGGGACCATGG No data
Right 952131580 3:30370312-30370334 ATGGAGGAAATGCTACCCTGAGG No data
952131576_952131581 9 Left 952131576 3:30370293-30370315 CCTGGCAACAGTTGGGACCATGG No data
Right 952131581 3:30370325-30370347 TACCCTGAGGAAGAATAGAGAGG No data
952131576_952131584 11 Left 952131576 3:30370293-30370315 CCTGGCAACAGTTGGGACCATGG No data
Right 952131584 3:30370327-30370349 CCCTGAGGAAGAATAGAGAGGGG No data
952131576_952131582 10 Left 952131576 3:30370293-30370315 CCTGGCAACAGTTGGGACCATGG No data
Right 952131582 3:30370326-30370348 ACCCTGAGGAAGAATAGAGAGGG No data
952131576_952131586 25 Left 952131576 3:30370293-30370315 CCTGGCAACAGTTGGGACCATGG No data
Right 952131586 3:30370341-30370363 AGAGAGGGGAAGAAATTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952131576 Original CRISPR CCATGGTCCCAACTGTTGCC AGG (reversed) Intergenic
No off target data available for this crispr