ID: 952132707

View in Genome Browser
Species Human (GRCh38)
Location 3:30383823-30383845
Sequence GACCCAGTGCTGGTTTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952132707_952132714 15 Left 952132707 3:30383823-30383845 CCTGTGGAAACCAGCACTGGGTC No data
Right 952132714 3:30383861-30383883 ATGGCACTGGGTCTCACCCAAGG No data
952132707_952132709 -4 Left 952132707 3:30383823-30383845 CCTGTGGAAACCAGCACTGGGTC No data
Right 952132709 3:30383842-30383864 GGTCTGACCTGAAGCCAGCATGG No data
952132707_952132712 3 Left 952132707 3:30383823-30383845 CCTGTGGAAACCAGCACTGGGTC No data
Right 952132712 3:30383849-30383871 CCTGAAGCCAGCATGGCACTGGG No data
952132707_952132710 2 Left 952132707 3:30383823-30383845 CCTGTGGAAACCAGCACTGGGTC No data
Right 952132710 3:30383848-30383870 ACCTGAAGCCAGCATGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952132707 Original CRISPR GACCCAGTGCTGGTTTCCAC AGG (reversed) Intergenic
No off target data available for this crispr