ID: 952134404

View in Genome Browser
Species Human (GRCh38)
Location 3:30400517-30400539
Sequence AAGGGCTTCATACTGTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952134404_952134407 -2 Left 952134404 3:30400517-30400539 CCAGCTGACAGTATGAAGCCCTT No data
Right 952134407 3:30400538-30400560 TTCCTGTCCATGTTTAGAGCAGG No data
952134404_952134411 12 Left 952134404 3:30400517-30400539 CCAGCTGACAGTATGAAGCCCTT No data
Right 952134411 3:30400552-30400574 TAGAGCAGGCCAATATGCCAGGG No data
952134404_952134410 11 Left 952134404 3:30400517-30400539 CCAGCTGACAGTATGAAGCCCTT No data
Right 952134410 3:30400551-30400573 TTAGAGCAGGCCAATATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952134404 Original CRISPR AAGGGCTTCATACTGTCAGC TGG (reversed) Intergenic
No off target data available for this crispr