ID: 952134405

View in Genome Browser
Species Human (GRCh38)
Location 3:30400535-30400557
Sequence GCTCTAAACATGGACAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952134405_952134410 -7 Left 952134405 3:30400535-30400557 CCCTTCCTGTCCATGTTTAGAGC No data
Right 952134410 3:30400551-30400573 TTAGAGCAGGCCAATATGCCAGG No data
952134405_952134411 -6 Left 952134405 3:30400535-30400557 CCCTTCCTGTCCATGTTTAGAGC No data
Right 952134411 3:30400552-30400574 TAGAGCAGGCCAATATGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952134405 Original CRISPR GCTCTAAACATGGACAGGAA GGG (reversed) Intergenic
No off target data available for this crispr