ID: 952134411

View in Genome Browser
Species Human (GRCh38)
Location 3:30400552-30400574
Sequence TAGAGCAGGCCAATATGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952134406_952134411 -7 Left 952134406 3:30400536-30400558 CCTTCCTGTCCATGTTTAGAGCA No data
Right 952134411 3:30400552-30400574 TAGAGCAGGCCAATATGCCAGGG No data
952134405_952134411 -6 Left 952134405 3:30400535-30400557 CCCTTCCTGTCCATGTTTAGAGC No data
Right 952134411 3:30400552-30400574 TAGAGCAGGCCAATATGCCAGGG No data
952134404_952134411 12 Left 952134404 3:30400517-30400539 CCAGCTGACAGTATGAAGCCCTT No data
Right 952134411 3:30400552-30400574 TAGAGCAGGCCAATATGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952134411 Original CRISPR TAGAGCAGGCCAATATGCCA GGG Intergenic
No off target data available for this crispr