ID: 952136503

View in Genome Browser
Species Human (GRCh38)
Location 3:30428480-30428502
Sequence CAGTCATATTGGCTCTACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952136496_952136503 27 Left 952136496 3:30428430-30428452 CCACAATGGGGATGACTAAGCTG No data
Right 952136503 3:30428480-30428502 CAGTCATATTGGCTCTACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952136503 Original CRISPR CAGTCATATTGGCTCTACTG GGG Intergenic
No off target data available for this crispr