ID: 952138954

View in Genome Browser
Species Human (GRCh38)
Location 3:30457167-30457189
Sequence ATGCTAAGCCAAATATAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952138954_952138957 1 Left 952138954 3:30457167-30457189 CCCATTTATATTTGGCTTAGCAT No data
Right 952138957 3:30457191-30457213 TTTTTATTTTGATATCTAGGTGG No data
952138954_952138956 -2 Left 952138954 3:30457167-30457189 CCCATTTATATTTGGCTTAGCAT No data
Right 952138956 3:30457188-30457210 ATGTTTTTATTTTGATATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952138954 Original CRISPR ATGCTAAGCCAAATATAAAT GGG (reversed) Intergenic
No off target data available for this crispr