ID: 952138956

View in Genome Browser
Species Human (GRCh38)
Location 3:30457188-30457210
Sequence ATGTTTTTATTTTGATATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952138951_952138956 30 Left 952138951 3:30457135-30457157 CCCTAATGCAACTAGTTTATGTC No data
Right 952138956 3:30457188-30457210 ATGTTTTTATTTTGATATCTAGG No data
952138955_952138956 -3 Left 952138955 3:30457168-30457190 CCATTTATATTTGGCTTAGCATG No data
Right 952138956 3:30457188-30457210 ATGTTTTTATTTTGATATCTAGG No data
952138952_952138956 29 Left 952138952 3:30457136-30457158 CCTAATGCAACTAGTTTATGTCA No data
Right 952138956 3:30457188-30457210 ATGTTTTTATTTTGATATCTAGG No data
952138954_952138956 -2 Left 952138954 3:30457167-30457189 CCCATTTATATTTGGCTTAGCAT No data
Right 952138956 3:30457188-30457210 ATGTTTTTATTTTGATATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952138956 Original CRISPR ATGTTTTTATTTTGATATCT AGG Intergenic
No off target data available for this crispr