ID: 952138957

View in Genome Browser
Species Human (GRCh38)
Location 3:30457191-30457213
Sequence TTTTTATTTTGATATCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952138955_952138957 0 Left 952138955 3:30457168-30457190 CCATTTATATTTGGCTTAGCATG No data
Right 952138957 3:30457191-30457213 TTTTTATTTTGATATCTAGGTGG No data
952138954_952138957 1 Left 952138954 3:30457167-30457189 CCCATTTATATTTGGCTTAGCAT No data
Right 952138957 3:30457191-30457213 TTTTTATTTTGATATCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952138957 Original CRISPR TTTTTATTTTGATATCTAGG TGG Intergenic
No off target data available for this crispr