ID: 952147107

View in Genome Browser
Species Human (GRCh38)
Location 3:30545315-30545337
Sequence CAGAACAAAGAAAAGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952147103_952147107 26 Left 952147103 3:30545266-30545288 CCATATGGGACATCACAAGTTTT No data
Right 952147107 3:30545315-30545337 CAGAACAAAGAAAAGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952147107 Original CRISPR CAGAACAAAGAAAAGTGTTG GGG Intergenic
No off target data available for this crispr