ID: 952149117

View in Genome Browser
Species Human (GRCh38)
Location 3:30567314-30567336
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952149115_952149117 11 Left 952149115 3:30567280-30567302 CCTGTTAGAGCAGAAAGAAAAAC No data
Right 952149117 3:30567314-30567336 CAGCTGACACCCACCCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr