ID: 952150963

View in Genome Browser
Species Human (GRCh38)
Location 3:30591223-30591245
Sequence TCCAGTTCATTTACTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952150963_952150969 25 Left 952150963 3:30591223-30591245 CCAGCTTCAGTAAATGAACTGGA No data
Right 952150969 3:30591271-30591293 CAGAATGGAGTGCATAGAATTGG No data
952150963_952150966 10 Left 952150963 3:30591223-30591245 CCAGCTTCAGTAAATGAACTGGA No data
Right 952150966 3:30591256-30591278 TCCTTTTCTATTTTCCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952150963 Original CRISPR TCCAGTTCATTTACTGAAGC TGG (reversed) Intergenic
No off target data available for this crispr