ID: 952150964

View in Genome Browser
Species Human (GRCh38)
Location 3:30591253-30591275
Sequence TTCTGGAAAATAGAAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952150964_952150970 17 Left 952150964 3:30591253-30591275 CCCTCCTTTTCTATTTTCCAGAA No data
Right 952150970 3:30591293-30591315 GTGTTAATTCTTTAAATACTTGG No data
952150964_952150969 -5 Left 952150964 3:30591253-30591275 CCCTCCTTTTCTATTTTCCAGAA No data
Right 952150969 3:30591271-30591293 CAGAATGGAGTGCATAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952150964 Original CRISPR TTCTGGAAAATAGAAAAGGA GGG (reversed) Intergenic
No off target data available for this crispr