ID: 952150965

View in Genome Browser
Species Human (GRCh38)
Location 3:30591254-30591276
Sequence ATTCTGGAAAATAGAAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952150965_952150969 -6 Left 952150965 3:30591254-30591276 CCTCCTTTTCTATTTTCCAGAAT No data
Right 952150969 3:30591271-30591293 CAGAATGGAGTGCATAGAATTGG No data
952150965_952150970 16 Left 952150965 3:30591254-30591276 CCTCCTTTTCTATTTTCCAGAAT No data
Right 952150970 3:30591293-30591315 GTGTTAATTCTTTAAATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952150965 Original CRISPR ATTCTGGAAAATAGAAAAGG AGG (reversed) Intergenic
No off target data available for this crispr