ID: 952150969

View in Genome Browser
Species Human (GRCh38)
Location 3:30591271-30591293
Sequence CAGAATGGAGTGCATAGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952150963_952150969 25 Left 952150963 3:30591223-30591245 CCAGCTTCAGTAAATGAACTGGA No data
Right 952150969 3:30591271-30591293 CAGAATGGAGTGCATAGAATTGG No data
952150965_952150969 -6 Left 952150965 3:30591254-30591276 CCTCCTTTTCTATTTTCCAGAAT No data
Right 952150969 3:30591271-30591293 CAGAATGGAGTGCATAGAATTGG No data
952150964_952150969 -5 Left 952150964 3:30591253-30591275 CCCTCCTTTTCTATTTTCCAGAA No data
Right 952150969 3:30591271-30591293 CAGAATGGAGTGCATAGAATTGG No data
952150967_952150969 -9 Left 952150967 3:30591257-30591279 CCTTTTCTATTTTCCAGAATGGA No data
Right 952150969 3:30591271-30591293 CAGAATGGAGTGCATAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952150969 Original CRISPR CAGAATGGAGTGCATAGAAT TGG Intergenic
No off target data available for this crispr