ID: 952156225

View in Genome Browser
Species Human (GRCh38)
Location 3:30646544-30646566
Sequence GAGGATCCATAACATTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952156225 Original CRISPR GAGGATCCATAACATTTGCA AGG Intronic
901923396 1:12551660-12551682 GAGGGTCCATAAGTTTTGCTGGG - Intergenic
902037616 1:13468925-13468947 GAGAATCCATAGCATGTCCAAGG + Intergenic
903963541 1:27072183-27072205 GAGGATACAGACCATTTACAGGG + Intergenic
906555729 1:46711471-46711493 CAGGATCCAGAATATTTTCAGGG - Intronic
908654294 1:66371606-66371628 GTAGATCCAAAACAATTGCATGG + Intronic
910523314 1:88148595-88148617 GAGGCTGCAAAACATTTGAAAGG - Intergenic
910549958 1:88464402-88464424 GAAGACCCATAACAATAGCAAGG - Intergenic
911838681 1:102654508-102654530 GAGGATGAATAAAATTTGCAAGG + Intergenic
914398829 1:147296797-147296819 GAGGATCTACAGCTTTTGCATGG - Intergenic
915650744 1:157308603-157308625 GAGGATCCAGAGCAATTTCATGG + Intergenic
920903064 1:210131920-210131942 GAGGCTTCAAAACCTTTGCAGGG - Intronic
923135904 1:231118587-231118609 GGGGATGGAAAACATTTGCAGGG - Intergenic
923752373 1:236757720-236757742 AAGGCTCCACAACATTTACAGGG + Intronic
923966985 1:239153158-239153180 GAAGAACCAAAACATTTACAAGG + Intergenic
1064172611 10:13047406-13047428 GGGGATCCCTAACATTTCAAAGG - Intronic
1069393554 10:67963674-67963696 AAGGATTCAGAACATTTGGAGGG - Intronic
1073847703 10:107577654-107577676 CACAATTCATAACATTTGCAAGG + Intergenic
1079337067 11:19579315-19579337 GAGAATCCTTAATATTTGCCAGG - Intronic
1081313902 11:41607365-41607387 GAGATTCCAGAACATTTGCTGGG - Intergenic
1082676390 11:56109889-56109911 GAGATTCCATTACATTTTCAAGG - Intergenic
1086094269 11:83034815-83034837 GAGGTTCCATAACTTGTCCAAGG + Intronic
1088504995 11:110518817-110518839 GAGGAAGCATAACATTTAGAAGG + Intergenic
1091357005 11:134944862-134944884 GAGGCTCCAGCAGATTTGCAGGG + Intergenic
1091652044 12:2318042-2318064 GAGGGTCCAGGACATTTGAAGGG + Intronic
1098458536 12:70704475-70704497 GAGGATCCAGAACATCATCAGGG + Intronic
1099948763 12:89276333-89276355 GAGGATCCAGTTCACTTGCAGGG - Intergenic
1100244985 12:92748666-92748688 GAGGTTAGATGACATTTGCAAGG + Intronic
1100276450 12:93076129-93076151 GAGGCTACATAACTTTTCCAAGG + Intergenic
1104404415 12:128505719-128505741 GAGTAGCCCTCACATTTGCAGGG - Intronic
1107843747 13:44488932-44488954 GAGGAACCATAAAATTTGTATGG + Intronic
1109113887 13:58356657-58356679 GATGATCCATGTCCTTTGCAGGG + Intergenic
1113899922 13:113791044-113791066 GAGCATCCCTAAAAATTGCAGGG - Intronic
1116326756 14:43540158-43540180 GAGGATCCATAACTTTTCTAAGG + Intergenic
1117564509 14:56979253-56979275 GAAGATCCATAAGATTGGCCAGG + Intergenic
1120476901 14:84999705-84999727 GGAGATGCAGAACATTTGCAAGG - Intergenic
1121791597 14:96703434-96703456 GAGGACCCATGACCTTTGCTTGG + Intergenic
1122294047 14:100694943-100694965 GTAGATCCAGCACATTTGCACGG + Intergenic
1122875295 14:104661267-104661289 GAGGAGCCATGACATTCCCAAGG - Intergenic
1128991407 15:72263664-72263686 GAGGGTGAATAACATTTGCAGGG - Intronic
1129945832 15:79538779-79538801 GCCTATCCTTAACATTTGCAAGG + Intergenic
1142902311 17:3019775-3019797 GAGGTGCCATAACATGTGCATGG + Intronic
1143688650 17:8540622-8540644 GAGAACCCATAAAATTTGCTAGG - Intronic
1147175099 17:38650675-38650697 GAGAATCCTGAAAATTTGCAGGG - Intergenic
1154497667 18:14974437-14974459 GAGGCTCCAGCAGATTTGCAGGG - Intergenic
1156517127 18:37689476-37689498 GATGAACCATTACATTAGCAAGG + Intergenic
926536272 2:14116869-14116891 GAAGAACCAAAGCATTTGCAAGG + Intergenic
928051938 2:28007940-28007962 AAGGATCCAAAACATTTTCCAGG - Intronic
933543821 2:83683936-83683958 GAGATTCCATAGAATTTGCAGGG - Intergenic
936766897 2:115861906-115861928 GAGGCTACATAATATTTGCTAGG + Intergenic
941219136 2:162753186-162753208 GAGAATGGATAACATTTGCTGGG + Intronic
944479002 2:200135898-200135920 GAGGTTCCAATACATTGGCAAGG + Intergenic
948454701 2:238099575-238099597 GGGGACCCATTACATTTGTAGGG - Intergenic
1170334157 20:15249560-15249582 AAGGCTCCATAGCAATTGCATGG + Intronic
1176349679 21:5782569-5782591 CAGGACCCATAACATGGGCAGGG + Intergenic
1176356493 21:5903153-5903175 CAGGACCCATAACATGGGCAGGG + Intergenic
1176544000 21:8180639-8180661 CAGGACCCATAACATGGGCAGGG + Intergenic
1176562951 21:8363684-8363706 CAGGACCCATAACATGGGCAGGG + Intergenic
1178958837 21:37045966-37045988 GAGCATCCGTATCATTGGCAAGG - Intergenic
1184030421 22:41891147-41891169 GAGGTCCCAGAACATTTGAACGG - Intronic
1203248869 22_KI270733v1_random:96862-96884 CAGGACCCATAACATGGGCAGGG + Intergenic
949247914 3:1946985-1947007 GAGGATATTTAACATTTGCCAGG - Intergenic
949701355 3:6762948-6762970 GAGGATGCAAAATATATGCAGGG + Intergenic
952156225 3:30646544-30646566 GAGGATCCATAACATTTGCAAGG + Intronic
952629336 3:35445879-35445901 GAAGAGCCATAAACTTTGCAAGG - Intergenic
952682558 3:36111460-36111482 GAGGAACCCCCACATTTGCATGG + Intergenic
952836510 3:37606937-37606959 GAGGGGCCATAACAATAGCAGGG + Intronic
956722085 3:72127017-72127039 GATGATCCATCACAGTGGCATGG - Intergenic
956866638 3:73375649-73375671 GTGGATCCATCATACTTGCAGGG + Intergenic
970566678 4:17338378-17338400 GTGGATCCACTAGATTTGCAGGG + Intergenic
973553637 4:52060036-52060058 GTGGAGCCACAAGATTTGCAAGG - Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
974819086 4:67043708-67043730 GAGGAGTCATGACATTGGCAGGG - Intergenic
976937513 4:90655691-90655713 GAGGATCCCTAAAATTTTGATGG + Intronic
978930483 4:114305094-114305116 CAGGAACAATAGCATTTGCAAGG - Intergenic
980300306 4:130982628-130982650 CAGGATACCTAACAATTGCAAGG - Intergenic
980521067 4:133934931-133934953 GTGGTTACCTAACATTTGCAAGG - Intergenic
983088169 4:163472947-163472969 GAGGATGCAGAAAATTGGCATGG - Exonic
983767307 4:171500168-171500190 TAGGATACATGACATTTTCAAGG + Intergenic
985943330 5:3156279-3156301 GAGTATTCATTACATTAGCATGG + Intergenic
990106921 5:52275801-52275823 GAGAATCTATAAGATATGCATGG + Intergenic
990842529 5:60099416-60099438 GAAAATCAAAAACATTTGCATGG + Intronic
992086684 5:73284061-73284083 GCAGATCCAGAACATTTGCTAGG - Intergenic
993489478 5:88528832-88528854 AAATATCCATAACATTTGAATGG - Intergenic
995876576 5:116796573-116796595 GAGGTTCCAAAACATGTCCATGG + Intergenic
996906893 5:128610947-128610969 GAGGAGCCATAATATTTGTAAGG + Intronic
998998954 5:147898645-147898667 GAGGAACAATGACATTTGGAGGG + Intronic
1004087602 6:12466125-12466147 GTGTATGCATAATATTTGCATGG + Intergenic
1006057666 6:31397466-31397488 GAGGATCCTTCATATTTTCATGG - Intergenic
1007975636 6:46098628-46098650 GAGGAAACATAGCCTTTGCAAGG + Intergenic
1013203504 6:107924754-107924776 GAGGACCTATAGCATTTTCATGG + Intronic
1017205012 6:151795604-151795626 GAAGATCCATCATATTTGTAAGG + Intronic
1018275116 6:162122151-162122173 GAGGCTCCATGACATTCACAGGG - Intronic
1021063506 7:16143910-16143932 TAGAATCCAGAACATTTGAAGGG + Intronic
1021787525 7:24166142-24166164 GAGGCTCCTTAACCTTGGCAGGG + Intergenic
1031305596 7:120122625-120122647 GATGAACCAGAACATTTGCTAGG + Intergenic
1039594050 8:38775215-38775237 TAGGATTCATAACCCTTGCAAGG - Intronic
1042150832 8:65781752-65781774 AGGTATCCATAACATTTACATGG + Intronic
1044593263 8:93934463-93934485 GAGTATCCAGGACATTTTCATGG + Intergenic
1045006690 8:97922236-97922258 GAGGATCCATACCGCTTTCACGG + Intronic
1049933615 9:479598-479620 GTGGATCCATACAAATTGCAAGG + Intronic
1051208839 9:14719990-14720012 GTGGGTACATAACATTTTCAGGG - Exonic
1051652587 9:19343924-19343946 GAGAACCAATAATATTTGCAAGG + Intronic
1052993181 9:34534330-34534352 GAGGCACCATCACATTTGCCTGG + Intergenic
1053456528 9:38237274-38237296 GAGGAAGCACAACATTTCCAAGG + Intergenic
1055865645 9:80809835-80809857 GAGGTTGGATAACATTTCCAAGG + Intergenic
1059145937 9:111899270-111899292 GAATATACATAACATTTCCATGG - Intronic
1203465269 Un_GL000220v1:80110-80132 CAGGACCCATAACATGGGCAGGG + Intergenic
1186083977 X:5966056-5966078 AATGATCAATACCATTTGCAAGG - Intronic
1188697376 X:33211961-33211983 GTGGATACATAACAAATGCATGG - Intronic
1189172989 X:38927053-38927075 GAGGATCCTTTTCTTTTGCAGGG + Intergenic
1193055989 X:77151615-77151637 GAAAATCCAGAACATTTTCAGGG + Intergenic
1195619247 X:106936477-106936499 AAGCACCCAAAACATTTGCACGG + Intronic
1198471470 X:136950867-136950889 GAGGAGCCACAACTGTTGCATGG - Intergenic