ID: 952156557

View in Genome Browser
Species Human (GRCh38)
Location 3:30649712-30649734
Sequence GTATACTCCTTGTCAACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952156557_952156563 22 Left 952156557 3:30649712-30649734 CCAGCTGTTGACAAGGAGTATAC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 952156563 3:30649757-30649779 GCCCAGCAAACAAAAAAAAGAGG 0: 1
1: 0
2: 0
3: 35
4: 585
952156557_952156562 0 Left 952156557 3:30649712-30649734 CCAGCTGTTGACAAGGAGTATAC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 952156562 3:30649735-30649757 CCTTTACACGCAATGCTCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 63
952156557_952156560 -1 Left 952156557 3:30649712-30649734 CCAGCTGTTGACAAGGAGTATAC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 952156560 3:30649734-30649756 CCCTTTACACGCAATGCTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 54
952156557_952156558 -2 Left 952156557 3:30649712-30649734 CCAGCTGTTGACAAGGAGTATAC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 952156558 3:30649733-30649755 ACCCTTTACACGCAATGCTCTGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952156557 Original CRISPR GTATACTCCTTGTCAACAGC TGG (reversed) Intronic
909843889 1:80365478-80365500 GTATTTTACTTGTAAACAGCAGG - Intergenic
911209756 1:95126853-95126875 GTATTCTCTTTGTCAGCAGTTGG + Intronic
920262385 1:204698071-204698093 ATATACTCCCTGCCAACTGCAGG - Intergenic
922628169 1:227074506-227074528 GTATACTACCTGTCAACAACTGG + Intronic
1062996168 10:1869362-1869384 GTATCCTCCGTGTCCTCAGCCGG - Intergenic
1064957009 10:20922517-20922539 GTCTATTCCTTCTCATCAGCAGG + Intronic
1066317820 10:34266112-34266134 GTATAATGGTTGTCAACAGAAGG + Intronic
1068829116 10:61472860-61472882 AAATACTCCTTGTCACCATCAGG + Intergenic
1069173834 10:65265189-65265211 CTAAACTCCTTGTCAAAAGTAGG - Intergenic
1072101891 10:92237474-92237496 CTATACTCCTCGTCAATATCAGG + Intronic
1074296487 10:112194055-112194077 CTATGCTACATGTCAACAGCAGG + Intronic
1074835802 10:117291888-117291910 ATTGAATCCTTGTCAACAGCTGG - Intronic
1077585457 11:3448185-3448207 GTATACTGCTTGTAAACATTTGG + Intergenic
1077586365 11:3456712-3456734 GTATACTGCTTGTAAACATTTGG + Intergenic
1079915973 11:26369022-26369044 ATATAGACCTTGTCAACTGCTGG - Intronic
1084242366 11:67830744-67830766 GTATACTGCTTGTAAACATTTGG + Intergenic
1092405649 12:8220422-8220444 GTATACTGCTTGTAAACATGTGG - Intergenic
1095298124 12:40550280-40550302 GTTTACTCCTTGTGAATTGCAGG + Intronic
1109650048 13:65313171-65313193 GGATACTCCTTTTCAACAAGAGG + Intergenic
1114735240 14:25036938-25036960 GTATATTCCGTGTAAAAAGCAGG - Intronic
1115037205 14:28872077-28872099 GTTTAGTTCTTGTCACCAGCTGG - Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1123720259 15:23054469-23054491 GTATACTCACTTTCATCAGCAGG + Intergenic
1126536068 15:49766542-49766564 GTCTACTCATTGTCAAAAGTAGG + Intergenic
1127505462 15:59593731-59593753 GTTTACCCCTTGTCATCATCTGG - Intergenic
1138681688 16:58688242-58688264 GGACACTCCTTGACAGCAGCAGG - Intergenic
1140340097 16:74149590-74149612 ATAATCTCCATGTCAACAGCAGG + Intergenic
1140575780 16:76166863-76166885 CTTTACTCCTTGGCAACAGAGGG + Intergenic
1141873739 16:86807162-86807184 CCAGCCTCCTTGTCAACAGCTGG - Intergenic
1146517779 17:33502587-33502609 GAATACTCATTGTCAACGACTGG + Intronic
1158359018 18:56651188-56651210 GTGCACTCCTTGCCCACAGCTGG + Intronic
1159057262 18:63478282-63478304 GTTTACTGCTTGGCAACAGTGGG + Intronic
928490603 2:31778770-31778792 GTATACTCCTTGGCTGCAGCAGG - Intergenic
933275348 2:80278060-80278082 GTATACACCTGGACAACGGCAGG - Intronic
943959985 2:194251932-194251954 GTAAACTCCTTGAGAATAGCTGG - Intergenic
949013489 2:241695910-241695932 GAATACTCCTTGTGAGCATCTGG - Intergenic
1172108948 20:32534271-32534293 TTTTATTCCTTGTCAAGAGCTGG - Intronic
1182325253 22:29507788-29507810 GCATACTACTGGTCAACAGCAGG + Exonic
949971909 3:9414677-9414699 GTATTCTCCTCATCAACAGATGG + Intronic
951145958 3:19227529-19227551 GTATACTCCTTCTCAAGCTCTGG - Intronic
952152284 3:30606540-30606562 GGAAACTCCTCGCCAACAGCTGG - Intronic
952156557 3:30649712-30649734 GTATACTCCTTGTCAACAGCTGG - Intronic
956201234 3:66708355-66708377 GAATGCTCTTTTTCAACAGCAGG + Intergenic
968247313 3:197165159-197165181 GTGTATTCCTTGTCAACAACTGG - Intronic
969760466 4:9177561-9177583 GTATACTGCTTGTAAACATTTGG + Intergenic
970916834 4:21345656-21345678 GTATGCTCCCTGTCAAAAGCTGG + Intronic
979084910 4:116395998-116396020 GAATATTCCTTATCAATAGCTGG + Intergenic
984140275 4:175997043-175997065 ATAAACTCGTAGTCAACAGCTGG + Intronic
990059722 5:51632593-51632615 GTATACTTCTGGGCCACAGCTGG + Intergenic
1001209734 5:169799091-169799113 TTATACTCATTGTCATCACCTGG + Intronic
1002992748 6:2253080-2253102 GTATATACCTTATCTACAGCAGG + Intergenic
1005681247 6:28210810-28210832 GTATATTACTTGTTAATAGCTGG - Intergenic
1015677271 6:135763883-135763905 GTTTTCTCCTAGTCAACAGCTGG + Intergenic
1019204565 6:170349190-170349212 GTAGACACTTTGTCAACAGTGGG - Intronic
1020389753 7:7645875-7645897 GTATAGTCCTTGTCAAAATTTGG + Intronic
1028202533 7:87978737-87978759 GTATCTTCCTTGAGAACAGCAGG + Intronic
1036262799 8:7253671-7253693 GTATACTGCTTGTAAACATTTGG + Intergenic
1036314839 8:7712210-7712232 GTATACTGCTTGTAAACATTTGG + Intergenic
1036375668 8:8197423-8197445 GTATACTGCTTGTAAACATTTGG - Intergenic
1036846046 8:12171371-12171393 GTATACTGCTTGTAAACATTTGG - Intergenic
1036853862 8:12225721-12225743 GTATACTGCTTGTAAACATTTGG + Intergenic
1036867411 8:12413690-12413712 GTATACTGCTTGTAAACATTTGG - Intergenic
1036875233 8:12468231-12468253 GTATACTGCTTGTAAACATTTGG + Intergenic
1036894676 8:12624321-12624343 GTATACTGCTTGCCAACATTTGG - Intergenic
1037347934 8:17919649-17919671 GTATGCTCCTTATCCACAGATGG - Intergenic
1046864124 8:119127128-119127150 TTATTCTCCTTGGCCACAGCTGG + Intergenic
1051652494 9:19342744-19342766 GTATATTTGATGTCAACAGCAGG + Exonic
1058112775 9:101049695-101049717 GTATACTCTTTTTCAACATATGG + Intronic
1060799924 9:126537316-126537338 GTGTACTCCTAGGCAGCAGCAGG - Intergenic
1062090326 9:134674298-134674320 GAATACTGCTTGGCAACAGAAGG + Intronic
1187265362 X:17727107-17727129 TTAAACTCATTGTCAACAGAAGG - Exonic
1191234147 X:58120545-58120567 GAATACTCCTTGCCAACTTCAGG + Intergenic
1195385573 X:104310908-104310930 GTTTTCTCCTTGTCAACACAGGG + Intergenic