ID: 952156642

View in Genome Browser
Species Human (GRCh38)
Location 3:30650533-30650555
Sequence CATAGAGCACATTCCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952156638_952156642 20 Left 952156638 3:30650490-30650512 CCTGAGATCTGTGCCAATTTTTT 0: 1
1: 0
2: 1
3: 22
4: 273
Right 952156642 3:30650533-30650555 CATAGAGCACATTCCTCCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 148
952156640_952156642 7 Left 952156640 3:30650503-30650525 CCAATTTTTTGTATCCTTGGTCT 0: 1
1: 0
2: 3
3: 71
4: 647
Right 952156642 3:30650533-30650555 CATAGAGCACATTCCTCCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 148
952156641_952156642 -7 Left 952156641 3:30650517-30650539 CCTTGGTCTGCAGTGTCATAGAG 0: 1
1: 0
2: 1
3: 5
4: 126
Right 952156642 3:30650533-30650555 CATAGAGCACATTCCTCCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952156642 Original CRISPR CATAGAGCACATTCCTCCTG TGG Intronic
900236493 1:1594124-1594146 CCTAGAGTCCATCCCTCCTGGGG + Intergenic
900951010 1:5858344-5858366 CATGGAGCCCAGTCCTCGTGGGG - Intergenic
901103912 1:6740667-6740689 CAAAGGGGACATTCATCCTGAGG - Intergenic
905649135 1:39644928-39644950 CAGTGAGCAAATTCTTCCTGAGG - Intergenic
907580888 1:55571644-55571666 CTAAGAGCATATTCCGCCTGAGG - Intergenic
907919253 1:58897328-58897350 CATGGATCACATGCCTCATGAGG - Intergenic
908961025 1:69696665-69696687 CATGGGGCAGATTCCTCATGAGG + Intronic
909343053 1:74553182-74553204 CATAGAGTTCATTTTTCCTGTGG + Intergenic
909425365 1:75518145-75518167 CATAAATGACATTCATCCTGAGG - Intronic
911193788 1:94973684-94973706 CCCAGAGTCCATTCCTCCTGCGG + Intergenic
913049972 1:115109019-115109041 CCTGGAGCACATTTGTCCTGAGG + Intergenic
917329990 1:173870777-173870799 CAGAGAGCTAAGTCCTCCTGAGG + Exonic
919564490 1:199167249-199167271 CATACAGAACCTGCCTCCTGGGG - Intergenic
923109025 1:230876371-230876393 CATTGAGCCCACTGCTCCTGTGG + Intergenic
923457220 1:234174938-234174960 CAAAGAGTTCAGTCCTCCTGGGG + Intronic
924499253 1:244621504-244621526 CTTAAAGCACAATCCTCCAGAGG - Intronic
1062800453 10:375528-375550 CATAGTGTACATTCCTCGTGAGG - Intronic
1063395906 10:5687243-5687265 CAGGGAACGCATTCCTCCTGGGG - Intronic
1064381210 10:14843324-14843346 CAAAGAGAACATTCCTGCTAAGG - Intronic
1067210827 10:44259404-44259426 CAGAGAGCACAGGGCTCCTGGGG + Intergenic
1071029250 10:81155062-81155084 CATAGAGCAAAATGTTCCTGTGG - Intergenic
1073669541 10:105572276-105572298 AATTGAGCACATTACTACTGAGG - Intergenic
1074340930 10:112629237-112629259 CATGCATCACATTCCTCCTTAGG + Intronic
1076332615 10:129681358-129681380 CATAGAGACCATGCTTCCTGTGG + Intronic
1076671159 10:132121790-132121812 CAGAGAGCACATCCTTGCTGGGG - Intronic
1078077917 11:8178382-8178404 CTTAGATCACATGCCTGCTGTGG - Intergenic
1079657116 11:22997893-22997915 CAAAGAACACATTCATCCTGAGG - Intergenic
1079942924 11:26704432-26704454 CACAGAGCAAATTCCTCTTTGGG - Intronic
1083277997 11:61608439-61608461 CATACTGCTCATTCCTCATGGGG + Intergenic
1087481456 11:98706428-98706450 CATAGAGAAAATACCTTCTGGGG + Intergenic
1087652770 11:100887765-100887787 CCAAGGGCACATCCCTCCTGAGG + Intronic
1087689259 11:101300614-101300636 CCTAGGTCACATTCTTCCTGGGG - Intergenic
1087797135 11:102466551-102466573 CATGTAGCGTATTCCTCCTGTGG - Intronic
1092240135 12:6831152-6831174 CTTAGAGCACATTGATCCTTGGG - Intronic
1093361808 12:18238159-18238181 CATGGAGATCATTCCACCTGTGG + Intronic
1094640408 12:32269393-32269415 CTTAGAGCATATTCTTCCTCAGG + Intronic
1097800087 12:63904351-63904373 AATAGAGCACAATCCTTCTAAGG - Intronic
1103013986 12:117480100-117480122 CATGGAAGACATTCCTACTGTGG - Intronic
1105065239 12:133191630-133191652 GATCGAGCACACTCCTCCTCAGG - Intronic
1108244260 13:48499050-48499072 CACAGATCACATCTCTCCTGTGG + Intronic
1109484061 13:62996237-62996259 CCTGGAGGGCATTCCTCCTGTGG + Intergenic
1109649263 13:65304755-65304777 CTCAGAACACATTCCTCCTTTGG - Intergenic
1110752286 13:79129034-79129056 CATAGTACACATTGCTCATGAGG - Intergenic
1114224320 14:20724064-20724086 CAAAGAACACATTCATCCCGAGG - Intergenic
1115859986 14:37673814-37673836 CATAGAGCAGTTTCCACCTATGG - Intronic
1119928816 14:78524315-78524337 GATATAGCACTTTCCTCCAGCGG - Intronic
1120140811 14:80927475-80927497 CCTGGAGGACATTCCTCTTGTGG - Intronic
1120714972 14:87830898-87830920 CAAAGTGCAGACTCCTCCTGAGG + Intergenic
1121090432 14:91177864-91177886 CATGGAGCACTGTACTCCTGAGG - Intronic
1121689022 14:95862256-95862278 TCTATAGCACATTCCTCTTGTGG - Intergenic
1121727269 14:96161856-96161878 CACAGAGCACATGTCTTCTGGGG + Intergenic
1122382439 14:101318146-101318168 CAAAGAACACATTCATCCCGAGG + Intergenic
1202886811 14_KI270722v1_random:115284-115306 ATTCGAGCACATTCCTGCTGTGG - Intergenic
1202886834 14_KI270722v1_random:115476-115498 ATTGGAGCACATTCCTGCTGTGG - Intergenic
1124721821 15:32117199-32117221 AACAGAGCCCATTCCTACTGGGG + Intronic
1125507320 15:40274304-40274326 CGCAGACCCCATTCCTCCTGAGG + Intronic
1128479335 15:68023775-68023797 CATAAATTAAATTCCTCCTGTGG + Intergenic
1130454845 15:84095443-84095465 ACTAGAGGAAATTCCTCCTGAGG + Intergenic
1135974184 16:27096468-27096490 CATGGAGCAAGTTACTCCTGGGG + Intergenic
1138612813 16:58140820-58140842 AATTGAGCACATTCCCCCTGGGG + Intergenic
1139872818 16:70121204-70121226 TATAGAGCATATTTCTCTTGGGG - Intronic
1140583430 16:76257688-76257710 CACACAGCACAGTGCTCCTGGGG - Intergenic
1141237807 16:82235500-82235522 CCAAGGGCACATTCTTCCTGGGG - Intergenic
1141353258 16:83318649-83318671 CACAGTGCACCTTCCTCCTGTGG + Intronic
1147004276 17:37389354-37389376 CAGAGAACACTTTCCTTCTGGGG - Exonic
1147032603 17:37652172-37652194 GATAGATCACATTCTGCCTGTGG - Intergenic
1151071985 17:71225204-71225226 CAAAGAGCATATTTGTCCTGGGG + Intergenic
1155471035 18:26193287-26193309 AATTAAGCACATTCCTCTTGTGG - Exonic
1156791872 18:40985202-40985224 TACAGAGCACATTACTTCTGAGG - Intergenic
1156811971 18:41263585-41263607 CATATAGCACTTTCCTCTTGGGG + Intergenic
1157951252 18:52040303-52040325 CAGAGAGCACATTTCTTCTTTGG + Intergenic
1160299649 18:77668420-77668442 CATGGAGCTGATTCCACCTGAGG + Intergenic
1161170684 19:2810978-2811000 CAGGGAACACACTCCTCCTGGGG - Intronic
1162222108 19:9186484-9186506 CAAAAAGCACTTTCCACCTGTGG + Exonic
1164497696 19:28783525-28783547 CGTAGAAAACATTCATCCTGTGG + Intergenic
1165701508 19:37942030-37942052 ATTACAACACATTCCTCCTGGGG + Intronic
1202662230 1_KI270708v1_random:82182-82204 ATTCGAGCACATTCCTGCTGTGG - Intergenic
1202662251 1_KI270708v1_random:82374-82396 ATTGGAGCACATTCCTGCTGTGG - Intergenic
926990622 2:18676354-18676376 CCTGGAGGACACTCCTCCTGTGG + Intergenic
927675482 2:25102824-25102846 CATAGGGAACATTCCTCATAAGG + Intronic
928598702 2:32882585-32882607 CAGAGAACATTTTCCTCCTGGGG + Intergenic
929560944 2:42956046-42956068 CATAGACCACCTTCCTCATTAGG + Intergenic
932504312 2:72214062-72214084 CATAAAGCCCATTCCTGCTGTGG + Intronic
933778345 2:85785333-85785355 CACAAAGCAGATTCCTGCTGGGG + Intronic
936622503 2:114115065-114115087 CACAGAGCACAATCTTCCTGAGG - Intergenic
936636209 2:114261545-114261567 CACAGAGCACATACACCCTGGGG - Intergenic
938109764 2:128556019-128556041 CACAGAGCAGGTTCCTCCCGTGG - Intergenic
940109879 2:150139993-150140015 CATGGAGCAGATTCCTAGTGGGG - Intergenic
940629226 2:156216745-156216767 CAAAATGCACATTACTCCTGTGG + Intergenic
942190646 2:173465477-173465499 CATAGATGACATGCCTCCTCTGG + Intergenic
943446832 2:187996375-187996397 CCTAGAGTACACTCCTCCTGTGG - Intergenic
944510029 2:200455620-200455642 CATCAACCACATTCCTACTGTGG - Intronic
946193305 2:218019137-218019159 CATAAAGCACATGTCTCCCGAGG + Intergenic
948380670 2:237547904-237547926 GCTAAAGCCCATTCCTCCTGGGG - Intronic
948404526 2:237707072-237707094 AATAGAACAAATTCCTCATGAGG + Intronic
1169404315 20:5310718-5310740 ACTAGAGCATATTCCTGCTGAGG - Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1173711309 20:45157986-45158008 CTTACAGCACACTCTTCCTGTGG + Intergenic
1174618673 20:51856883-51856905 CTGATAGCATATTCCTCCTGAGG - Intergenic
1175237110 20:57522407-57522429 CATAGGACAAATTCATCCTGTGG + Intronic
1175795913 20:61770557-61770579 GATAGTGCACATGACTCCTGCGG - Intronic
1179554464 21:42163445-42163467 CAAAGAGCAGATTGCTCCTTAGG + Intergenic
1179956049 21:44739287-44739309 CAAAAAACACATTTCTCCTGGGG + Intergenic
1180329050 22:11459772-11459794 ATTCGAGCACATTCCTGCTGTGG - Intergenic
1180329073 22:11459964-11459986 ATTGGAGCACATTCCTGCTGTGG - Intergenic
1180957576 22:19747781-19747803 CAAACAGGCCATTCCTCCTGTGG - Intergenic
1182038339 22:27216738-27216760 CTTGGAGCACAGTCCTGCTGGGG - Intergenic
1182084437 22:27551582-27551604 CACAGAGCAAAGACCTCCTGGGG + Intergenic
950069807 3:10142808-10142830 TGGAGAACACATTCCTCCTGGGG + Intronic
952156642 3:30650533-30650555 CATAGAGCACATTCCTCCTGTGG + Intronic
953847143 3:46436681-46436703 CATAGACCACATGCTTCTTGAGG - Intronic
958771199 3:98428234-98428256 AGTAGTGCACATTCCTGCTGTGG + Intergenic
960107360 3:113812926-113812948 TATGGAGCACAATCCTGCTGGGG + Intergenic
960196401 3:114773778-114773800 CACAGATCACATGCCTACTGGGG + Intronic
961749393 3:129086517-129086539 CATAAAGCACTCCCCTCCTGGGG + Intergenic
965389046 3:168082057-168082079 TTTAGGGCAAATTCCTCCTGAGG - Intronic
968748705 4:2374954-2374976 GACAGAGCCCAGTCCTCCTGTGG + Intronic
969563798 4:7965844-7965866 CAGGGAGCACATCGCTCCTGGGG + Intronic
969584143 4:8082286-8082308 CACTGAGCGTATTCCTCCTGCGG + Intronic
970865526 4:20754484-20754506 CAGAGATCACATTCTTCCTTAGG + Intronic
972209979 4:36824524-36824546 CCTGGAGGGCATTCCTCCTGTGG - Intergenic
979549270 4:121972188-121972210 CAAAGAGTACTTTGCTCCTGAGG + Intergenic
981179947 4:141729554-141729576 CACCGAGCACATTTCCCCTGTGG - Intronic
981508505 4:145529299-145529321 AACAGAGCACCTTCCTTCTGTGG + Intronic
982288485 4:153758437-153758459 CAGAGAGGCCATACCTCCTGAGG + Intronic
1002374785 5:178780926-178780948 CATATAGCTCATTCCTCCAGTGG - Intergenic
1003246590 6:4387167-4387189 CGAAGAACACATTCATCCTGAGG + Intergenic
1003339532 6:5206267-5206289 CATAGGCCAGCTTCCTCCTGTGG - Intronic
1007329932 6:41098421-41098443 CATAGAGCACGATTCTCCAGTGG + Exonic
1009614858 6:65991019-65991041 CCTGGAGGGCATTCCTCCTGTGG - Intergenic
1015535342 6:134262049-134262071 CATGGTGCACATCCCTCCAGGGG - Exonic
1015622503 6:135146372-135146394 AAGAGAACACATCCCTCCTGCGG + Intergenic
1019554886 7:1624308-1624330 CTCAGGGCAGATTCCTCCTGAGG + Intergenic
1020004413 7:4774749-4774771 CAGAGATCAGTTTCCTCCTGGGG + Intronic
1020430419 7:8112073-8112095 CATAAAGCACAGTCCTTGTGAGG + Intergenic
1021779136 7:24084726-24084748 CATAGAGCAAAAGCTTCCTGAGG - Intergenic
1028284614 7:88981088-88981110 GACACAGCACATTCCTACTGTGG - Intronic
1030175846 7:106652269-106652291 CCTAGAGGAGATTCCTCCAGGGG + Intergenic
1033176797 7:139132103-139132125 CATAGCACAGATTCCTCCTTGGG - Intergenic
1034899451 7:154898495-154898517 CACAGAGCACATTCCCACCGAGG - Intergenic
1039896317 8:41719170-41719192 CCCAGAGCAAATCCCTCCTGTGG - Intronic
1042786058 8:72548417-72548439 AATAGGGCACATTCCTTCTTTGG + Intronic
1042966801 8:74362329-74362351 CATAAAGCACACTCCTCAGGGGG - Intronic
1045909829 8:107394026-107394048 TTTAGAGCCCATTCATCCTGAGG + Intronic
1046976453 8:120283706-120283728 CAAAGAGCAAATGGCTCCTGTGG - Exonic
1047926297 8:129686208-129686230 TATAGAGCACCTCTCTCCTGAGG - Intergenic
1048558603 8:135507637-135507659 CACAGAGGACATTCCCACTGGGG - Intronic
1051488566 9:17635578-17635600 TATCCAGCACATGCCTCCTGGGG + Intronic
1053428172 9:38024780-38024802 AATCCAGCACATCCCTCCTGAGG + Intronic
1062004556 9:134232734-134232756 CGCAGACCAGATTCCTCCTGGGG + Intergenic
1062309953 9:135930198-135930220 CCCAGAGGACATTCCTGCTGGGG - Intergenic
1186220830 X:7347545-7347567 ACTAGAGCACAATCCTCCTCAGG - Intronic
1187049364 X:15680526-15680548 CATAAAGTACATTCCTGGTGAGG + Intergenic
1187095975 X:16149022-16149044 CTGAGATCACATTCTTCCTGGGG + Intronic
1189707464 X:43773184-43773206 CATAATGCACATACCACCTGAGG - Intronic
1197134898 X:123049677-123049699 GATGTAACACATTCCTCCTGGGG - Intergenic
1199159036 X:144586354-144586376 CCTAGAGGGCACTCCTCCTGCGG + Intergenic
1199769457 X:150965077-150965099 CAATCAGCACCTTCCTCCTGAGG - Intergenic
1201470097 Y:14323618-14323640 CATAGAGTTCATTTCTCCTGAGG - Intergenic