ID: 952157140

View in Genome Browser
Species Human (GRCh38)
Location 3:30655699-30655721
Sequence CAGCACTACTTGGCCAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952157140_952157143 -6 Left 952157140 3:30655699-30655721 CCATTATTGGCCAAGTAGTGCTG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 952157143 3:30655716-30655738 GTGCTGATAAATGGTACCTGTGG 0: 1
1: 0
2: 0
3: 13
4: 88
952157140_952157150 27 Left 952157140 3:30655699-30655721 CCATTATTGGCCAAGTAGTGCTG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 952157150 3:30655749-30655771 GATTTAAGGAGATGATGCTTGGG 0: 1
1: 0
2: 2
3: 17
4: 205
952157140_952157144 -5 Left 952157140 3:30655699-30655721 CCATTATTGGCCAAGTAGTGCTG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 952157144 3:30655717-30655739 TGCTGATAAATGGTACCTGTGGG 0: 1
1: 0
2: 1
3: 7
4: 115
952157140_952157149 26 Left 952157140 3:30655699-30655721 CCATTATTGGCCAAGTAGTGCTG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 952157149 3:30655748-30655770 GGATTTAAGGAGATGATGCTTGG 0: 1
1: 1
2: 2
3: 22
4: 265
952157140_952157148 13 Left 952157140 3:30655699-30655721 CCATTATTGGCCAAGTAGTGCTG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 952157148 3:30655735-30655757 GTGGGTTGTTGTGGGATTTAAGG 0: 1
1: 0
2: 3
3: 19
4: 303
952157140_952157145 4 Left 952157140 3:30655699-30655721 CCATTATTGGCCAAGTAGTGCTG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 952157145 3:30655726-30655748 ATGGTACCTGTGGGTTGTTGTGG 0: 1
1: 0
2: 2
3: 5
4: 135
952157140_952157146 5 Left 952157140 3:30655699-30655721 CCATTATTGGCCAAGTAGTGCTG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 952157146 3:30655727-30655749 TGGTACCTGTGGGTTGTTGTGGG 0: 1
1: 0
2: 1
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952157140 Original CRISPR CAGCACTACTTGGCCAATAA TGG (reversed) Intronic
902129790 1:14249742-14249764 CAGCCCCACCTGGCCAATCAGGG - Intergenic
906817658 1:48895636-48895658 AAGCTCCAGTTGGCCAATAAAGG - Intronic
910463695 1:87474524-87474546 AAGAACTACGTGGCCAAAAAGGG - Intergenic
914079491 1:144393776-144393798 CAGAAGTACCTTGCCAATAAGGG - Intergenic
914099687 1:144572726-144572748 CAGAAGTACCTTGCCAATAAGGG + Intergenic
914358419 1:146908988-146909010 AAGAACTACGTGGCCAAAAAGGG - Intergenic
914495006 1:148188019-148188041 AAGAACTACGTGGCCAAAAAGGG + Intergenic
914977944 1:152383240-152383262 CAACACTATTTGGCAAAAAAAGG - Intergenic
917033486 1:170720911-170720933 GAACACTACTTGGCATATAAGGG - Intronic
922026389 1:221753405-221753427 CAACACTACTTGGCCATCTAGGG + Intergenic
922944449 1:229499758-229499780 CAGCAAGGCTTGGCCAATAGCGG + Exonic
922995068 1:229950489-229950511 GAATACTACTTGGCCATTAAAGG - Intergenic
1065248820 10:23788341-23788363 GAGAACTCCTTGGCAAATAAAGG - Intronic
1068262549 10:54601138-54601160 TAGCAGTACTTGCTCAATAAAGG + Intronic
1069419062 10:68230126-68230148 CAGTACAAGTTGGACAATAAGGG - Intergenic
1073331345 10:102671871-102671893 CAGCACTCCCTGCCCAAAAAAGG - Intergenic
1076755906 10:132571581-132571603 CAGCACTATCTGGCACATAAAGG - Intronic
1078742428 11:14079738-14079760 GATCAGTACTTGGGCAATAAAGG - Intronic
1078892751 11:15572392-15572414 CAGCACTACCTGGTGAGTAAGGG + Intergenic
1087180803 11:95140532-95140554 CAGCAAAACTTGACCAATAGGGG + Intergenic
1088784650 11:113170206-113170228 CAGCACTCCATGGCTAATAGAGG + Intronic
1094594068 12:31848004-31848026 CAGCACTAATTGGCCAACTTTGG + Intergenic
1097807812 12:63985200-63985222 AAGGACTAGTTGGTCAATAAAGG + Intronic
1106505995 13:30370843-30370865 CAGCACTATTAGGCCCTTAAAGG + Intergenic
1110568099 13:76976431-76976453 CACCACTCCTTGGCGAAGAAGGG + Intergenic
1113424765 13:110198940-110198962 CATTTCTACTTGGCCAATGAGGG + Intronic
1115257192 14:31415846-31415868 AAGCATTACTTGGGCAATACAGG + Intronic
1116078229 14:40140456-40140478 CAACACAACTTGCACAATAATGG - Intergenic
1119913105 14:78369256-78369278 CAGTAGTGCTTTGCCAATAAAGG + Intronic
1131965464 15:97837537-97837559 CAGCATTTCTTGGCCAAACAAGG + Intergenic
1133743091 16:8666189-8666211 AAGCAGTTCTTGGCCAATGACGG + Intergenic
1136528365 16:30848332-30848354 CAGCCTTACTTGGCCTACAAAGG - Intronic
1138603253 16:58070466-58070488 CAGCACACCTGGGCCAGTAAAGG + Intergenic
1154321722 18:13359433-13359455 CAGCAGGACTTGCCCAACAATGG + Intronic
1156477857 18:37417517-37417539 TAGCACCACTTGGCCAACAGAGG - Intronic
1160630665 18:80245108-80245130 CAGCTCCACTTGGCAAAGAAGGG - Intronic
1168561664 19:57389789-57389811 CGGCACGACTTACCCAATAAAGG + Intronic
934132533 2:88962614-88962636 CAGCAGTGCTTGACTAATAATGG + Intergenic
943003090 2:182354544-182354566 CAGAACAACTTGGCAGATAAGGG + Intronic
1169948324 20:11013574-11013596 CAGCACTACTTGGCTTATAGTGG - Intergenic
1170150232 20:13220839-13220861 CAGCTCCAGTTTGCCAATAAAGG + Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1174101256 20:48127748-48127770 CAGCACTTTTTTGCCAGTAAAGG - Intergenic
949143723 3:668971-668993 CAACACTTCCTGGTCAATAAAGG + Intergenic
952157140 3:30655699-30655721 CAGCACTACTTGGCCAATAATGG - Intronic
957860917 3:85947335-85947357 CAGCAGTACTTCGATAATAAAGG + Intronic
963035699 3:141025949-141025971 CAGGACTACATGACCAAAAAAGG - Intergenic
964027067 3:152087352-152087374 CAGCATGACATGGCAAATAATGG + Intergenic
966461662 3:180183186-180183208 CAGCACGATTTGGCCACTATAGG - Intergenic
981667311 4:147244492-147244514 CTCCATTACTTGGCCAATAAAGG - Intergenic
983283615 4:165711655-165711677 CAGCAGGATTTGGCCAATAATGG + Intergenic
990349168 5:54898649-54898671 CAGCAGTGCTTGGGCCATAATGG + Intergenic
990864999 5:60370215-60370237 CAGCACTACTTGGGCAAACTGGG - Intronic
993603814 5:89962302-89962324 TAGCACAACTTGGCCAGAAAAGG + Intergenic
993612167 5:90068345-90068367 CAGGACAACTTGGCCCATACTGG + Intergenic
993682475 5:90896865-90896887 CAGCATTAATTGGGCAAGAAGGG + Intronic
995091062 5:108177956-108177978 TAGCACTACATGGCCAATCATGG + Intronic
997640190 5:135443844-135443866 CAGCACTCCTGGGCCATTACTGG - Intergenic
1003731573 6:8830365-8830387 CAGCAGGACTTGGAAAATAAGGG - Intergenic
1010701759 6:79057370-79057392 CAGAACTACTAAGCCAATATTGG - Intronic
1011121451 6:83958184-83958206 TATCATTACTTGGCCAATAATGG + Intronic
1023318781 7:38970910-38970932 CAGCCTTACTTGGACAACAAAGG - Intergenic
1023349399 7:39305133-39305155 CAGCACTAGATGTCCAACAATGG - Intronic
1031835232 7:126673333-126673355 CAACACTACTTGGGCAATTTAGG + Intronic
1033870520 7:145749667-145749689 CAGCACATTTTGGTCAATAAAGG - Intergenic
1038148384 8:24919055-24919077 CAGCAGTACTTGCTCAATAAAGG + Exonic
1043844531 8:85149192-85149214 CAGCACTAGTTCCCCAACAATGG + Intergenic
1045622935 8:104003944-104003966 CAGCAATACTTGATAAATAATGG + Intronic
1049081595 8:140447557-140447579 CAACACTACATGGACAAGAATGG + Intronic
1189598962 X:42601005-42601027 CAGAACTACTATGCCAATGAAGG - Intergenic
1191612947 X:63136359-63136381 CAGCACCACTTGGCCAACTTTGG + Intergenic
1191623350 X:63242567-63242589 CAGCACCACTTGGCCAACTTTGG - Intergenic
1197268617 X:124402293-124402315 TAACACCACCTGGCCAATAAGGG + Intronic