ID: 952159643

View in Genome Browser
Species Human (GRCh38)
Location 3:30680940-30680962
Sequence CACCAAAGGGGGCCCTGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952159643_952159649 20 Left 952159643 3:30680940-30680962 CCTGTTCAGGGCCCCCTTTGGTG 0: 1
1: 1
2: 0
3: 5
4: 127
Right 952159649 3:30680983-30681005 CTCGTCATCCCCAGCCAAACTGG 0: 1
1: 0
2: 0
3: 24
4: 1651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952159643 Original CRISPR CACCAAAGGGGGCCCTGAAC AGG (reversed) Intronic
900613388 1:3553772-3553794 CTTCACAGGGGGCCCTGCACTGG + Intronic
901196936 1:7445517-7445539 CACCCAAGGTGACCCTGGACGGG + Intronic
902686028 1:18078231-18078253 TCCCAAAGGGGGCCCTGCTCTGG + Intergenic
903656307 1:24950684-24950706 AAGCACAGGGGGCCATGAACAGG + Intronic
905652080 1:39663254-39663276 CAGCAAAGGGGTCCCTGAGGTGG - Intronic
906799259 1:48721658-48721680 GACCACAGGGGTCCCTGATCTGG - Intronic
914225280 1:145714781-145714803 CATCACAGTAGGCCCTGAACTGG + Intergenic
915044332 1:152999520-152999542 CACCAATGGAGGACATGAACTGG - Intergenic
917197615 1:172483113-172483135 CACTTAAGGGGGCACTGAAGTGG + Intergenic
920386116 1:205571004-205571026 CCCAACAGGGGGCTCTGAACAGG + Intronic
1068958733 10:62845155-62845177 CTTCAAAGGGGGCCTTGCACAGG + Intronic
1075733260 10:124648775-124648797 CAGCAAAAGGAGCCCCGAACAGG - Intronic
1075765280 10:124887957-124887979 CACCAAAGGGGTACCTCACCTGG + Intergenic
1075960883 10:126567006-126567028 CACCAAAGGTGGCCCTGGGTGGG + Intronic
1076740151 10:132478868-132478890 CACCGACGGGAGCCCTGAAAGGG - Intergenic
1076991477 11:278361-278383 CACCAAACGGAGCCCTTAAAGGG + Intronic
1077539308 11:3139156-3139178 CACCCCAGGGTCCCCTGAACGGG - Intronic
1078434585 11:11313955-11313977 CACCAAATCGGGCACAGAACTGG - Intronic
1079324125 11:19476953-19476975 CACCTGAGGGGGCCATGAAGAGG - Intronic
1080874566 11:36264265-36264287 CTCCAAAGGGCACCCTGCACTGG - Intergenic
1083656369 11:64231712-64231734 CTCCAAAGGGGGTGCTGATCTGG + Intronic
1085662769 11:78384509-78384531 TGCCAAAGGGGACCCAGAACTGG + Intronic
1095582231 12:43813513-43813535 CACCACACCTGGCCCTGAACTGG + Intergenic
1099401110 12:82204652-82204674 CACCAAAGGGTGACCTCAGCAGG - Intergenic
1103951759 12:124555229-124555251 CTCCAGAGAGGGCCCTGAGCTGG - Intronic
1110650525 13:77937132-77937154 CTGCTAAGTGGGCCCTGAACTGG + Intergenic
1113535952 13:111066550-111066572 CACCAAACGGGGCTCTGTCCTGG - Intergenic
1119814667 14:77555209-77555231 TAGCAGATGGGGCCCTGAACTGG - Intronic
1121060024 14:90898476-90898498 CAACAAAGAGAGCCCAGAACTGG + Intronic
1124639991 15:31391498-31391520 TAACAATGGGGGCCCTGCACCGG + Intronic
1127709741 15:61584714-61584736 CACCAAAGGCGGCCCTGGCATGG - Intergenic
1128131445 15:65229761-65229783 CTCCAGAGGGGGCCCAGAACAGG - Intergenic
1129083878 15:73067902-73067924 CACCACACTGGGCCCTGAAATGG + Intronic
1130994544 15:88896554-88896576 GACCAATGGGGGCCCTGGCCTGG + Intergenic
1134411465 16:14005752-14005774 GGCCTAAGGGGGCCCTGGACTGG - Intergenic
1137955476 16:52824849-52824871 CCAGAAAGGGGGCCCTGACCAGG - Intergenic
1137982437 16:53081228-53081250 CACCAAAGACTGTCCTGAACTGG - Intronic
1139329177 16:66174348-66174370 AACCAGAGGGGGCTCTGACCAGG + Intergenic
1140192121 16:72826978-72827000 CAACAAAGGCTGCCCTAAACTGG + Intronic
1142138657 16:88462912-88462934 GACCACAGGGGGCCCTGGCCCGG - Intronic
1142621627 17:1169082-1169104 CACCAAAGCTGGCCCTGCAGGGG + Intronic
1147371577 17:39996472-39996494 CAGCACAGGGGGCCCAGAATGGG + Intronic
1149649341 17:58267286-58267308 CCCCAAAGGAGGCTGTGAACAGG + Intronic
1151618659 17:75231509-75231531 GGGCTAAGGGGGCCCTGAACAGG + Intronic
1151691860 17:75691510-75691532 TACCTAAGGAGGCCCTGAAGTGG + Intronic
1154441297 18:14392496-14392518 CACCAAAGGGGTCCGGGAAGTGG - Intergenic
1155833790 18:30552599-30552621 CACCAGAGGCGGCCCTAAAATGG - Intergenic
1157891821 18:51425445-51425467 CAGGAAAGAGGTCCCTGAACTGG + Intergenic
1160607051 18:80059164-80059186 CACCACAGGGGTCCATGCACAGG - Intronic
1161531646 19:4793258-4793280 CACCAAAGGGGTCCGGGAAGTGG + Exonic
1161534380 19:4809971-4809993 CCCCAAAGGGGACCCTAGACTGG - Intergenic
1162320199 19:9967124-9967146 CACCCATGGGGGCTCTGACCTGG - Intronic
1163666788 19:18607141-18607163 GACCAAAGGGGCCACTGAAGAGG - Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1166566174 19:43766965-43766987 GACCAAAGGGGGCCCTGGCTTGG - Exonic
1167715022 19:51137581-51137603 AACCAGAGAGGGCCCTGAGCAGG - Intergenic
925012969 2:499874-499896 CACCAAGGGGGGTCCTGCACAGG - Intergenic
925386665 2:3466707-3466729 CACCACAGGGGCCCATGGACAGG - Intronic
927813484 2:26193822-26193844 CCCCAAAGGGCTCCCTGTACTGG + Intronic
930633922 2:53784732-53784754 AATCAAAGGGGGCCCTAATCTGG - Intronic
932344929 2:70989123-70989145 CTCCAAAGGGGGCCCAGGCCTGG + Intronic
935376007 2:102398237-102398259 CCCCAAAGGGAGCCCAGCACTGG + Exonic
937093530 2:119222289-119222311 CACCAGAGGGGGCTAGGAACTGG + Intergenic
937911358 2:127077164-127077186 CAGCAGAGCAGGCCCTGAACCGG + Intronic
948506269 2:238428831-238428853 CAGCAGAGGGGGCCCAGAAGAGG + Intronic
1175292677 20:57888273-57888295 GACCAAAGGGTGCCCTGGAGAGG + Intergenic
1175793477 20:61756954-61756976 CCCAAAAGGTGGCCCTCAACGGG + Intronic
1176090160 20:63315069-63315091 CACCCAGGAGTGCCCTGAACTGG - Intronic
1176454760 21:6898678-6898700 CACCAAAGGGGTCCGGGAAGTGG + Intergenic
1176832932 21:13763726-13763748 CACCAAAGGGGTCCGGGAAGTGG + Intergenic
1183442136 22:37829272-37829294 CACCCAAGTGGTCCCTGAGCTGG - Intergenic
1185255266 22:49827990-49828012 GGCCAAAGGGGGCCCTGAGGCGG + Intergenic
950918383 3:16668016-16668038 CTCCAGAGGGGGCACTGAAAGGG + Intronic
952159643 3:30680940-30680962 CACCAAAGGGGGCCCTGAACAGG - Intronic
955557349 3:60152140-60152162 CACCAAAGGGAACCAAGAACAGG - Intronic
956219115 3:66883489-66883511 AACCTAAGGGGGTCCTGAATTGG + Intergenic
959533317 3:107458169-107458191 TCTTAAAGGGGGCCCTGAACTGG + Intergenic
961381980 3:126501088-126501110 CAACAAGGGTGGCGCTGAACTGG + Intronic
961495578 3:127288586-127288608 CACCAAATGGTGTCCTGAGCGGG + Intergenic
961712762 3:128839986-128840008 CTGCTAAGCGGGCCCTGAACTGG + Intergenic
965856079 3:173089562-173089584 AACCAGAGGAGGCCCTGAAAAGG + Intronic
968478070 4:821700-821722 CAGCAAAAGTGGCCTTGAACTGG - Intronic
968893584 4:3385539-3385561 CCCCAACGGGAGCCCTGATCAGG - Intronic
973737564 4:53887705-53887727 CACCAAAAGGGGCCTTGCAAGGG - Intronic
978963155 4:114708902-114708924 GATGAAAGGGGGCCATGAACAGG - Intergenic
985829186 5:2215419-2215441 CATGAAAGGGAGCCCTGATCTGG - Intergenic
987071734 5:14343367-14343389 CATCAAAGGGTTCCCTGCACTGG + Intronic
989100376 5:37817791-37817813 AACCACAGTGGCCCCTGAACTGG + Intronic
991317970 5:65332750-65332772 CAACAGAGGGGACTCTGAACTGG - Intronic
995222360 5:109664310-109664332 CACCAAAGGAAGCCTTGAGCTGG - Intergenic
995610878 5:113909254-113909276 CTCCTGAGGGGGCCCTGAAGAGG - Intergenic
997690158 5:135822930-135822952 CAGCAAAGATGGCCCTGAGCTGG + Intergenic
998810893 5:145964757-145964779 CACCAAAGGGAGCCCTGTGGTGG - Intronic
999187333 5:149721486-149721508 CACCAAAATGAGCTCTGAACTGG - Intergenic
999371700 5:151059413-151059435 CACCTGAGGGGGCCCTGCACTGG + Intronic
999781027 5:154850545-154850567 CACCAAAGCGGGGGCTGAAAGGG - Exonic
1000297025 5:159921076-159921098 AACAAATGGGGCCCCTGAACAGG - Intronic
1000907578 5:166981129-166981151 CAACACAGGGGACCCAGAACAGG - Intergenic
1001264308 5:170261604-170261626 CACCAAGGTGGGCCCTGAGAGGG - Intronic
1002315618 5:178341382-178341404 CACCAAAGTGTGCCCTGCATGGG - Intronic
1003847983 6:10193804-10193826 CACCAAATGGGCCTCTGAATAGG - Intronic
1005463793 6:26092676-26092698 CACCAAAGGAGGCACTTGACAGG - Exonic
1006790525 6:36698320-36698342 CACCAAAGGGCGCTCAGAACTGG - Intronic
1011751837 6:90461745-90461767 GACAGAAGGTGGCCCTGAACAGG + Intergenic
1011847062 6:91578980-91579002 CTGCAAATGGGGCCCTGCACTGG + Intergenic
1015862134 6:137692190-137692212 CACCAAAGGGTGACCTCAGCTGG + Intergenic
1017747781 6:157462025-157462047 CACCAGAGGGGGCTCTGCAGGGG + Intronic
1017888484 6:158620458-158620480 CACCAAAGGGCTTCCCGAACCGG + Intronic
1018235695 6:161721634-161721656 CACCAAAGAGGGCCCTGAACAGG - Intronic
1019207516 6:170375090-170375112 CAGCAGAGGGAGCCCTGAACTGG - Intronic
1023017454 7:35982287-35982309 CACCAAAGGGGGCCAGGCCCAGG - Intergenic
1026315114 7:69221176-69221198 CACCTAAGAGAGCCATGAACAGG - Intergenic
1029111322 7:98214276-98214298 CACCTTAAGGGGCCCTGACCAGG - Intergenic
1029709873 7:102293600-102293622 CACCACAGGGGGCCCTGGCTGGG + Intronic
1031614891 7:123868722-123868744 GACCACAGTGGGCCCGGAACTGG + Exonic
1032087356 7:128891113-128891135 CATCAAAGGGGCCCAGGAACAGG + Intronic
1032783274 7:135181452-135181474 CACCAAAGGGGGGAATGAAGTGG + Intergenic
1033118262 7:138645219-138645241 CACCAAAGGGTGACAGGAACAGG + Intronic
1039431691 8:37529812-37529834 CACCCATGGGTGCCCTGAAAGGG - Intergenic
1040913364 8:52543474-52543496 CACATAAGGCTGCCCTGAACTGG - Intronic
1041711996 8:60902914-60902936 CACCAAATGGGTCCCTGGGCTGG - Intergenic
1043594679 8:81870724-81870746 CAACAAAAGGCACCCTGAACAGG - Intergenic
1049624410 8:143613617-143613639 CACCAAGGGGAGGCCTGACCCGG - Intronic
1050476834 9:6049176-6049198 CACAAAAAGGGTCCCTGAGCTGG - Intergenic
1053539354 9:38957854-38957876 AACCAAAGTGGACCCTGACCAGG - Intergenic
1054626785 9:67406064-67406086 AACCAAAGTGGACCCTGACCAGG + Intergenic
1056987114 9:91373614-91373636 ACCCAAAGTGGGCCCTCAACAGG - Intergenic
1060014351 9:120073605-120073627 CACCAAATGAGGTCCTGAGCAGG + Intergenic
1061848781 9:133402725-133402747 CACTCAATGGAGCCCTGAACAGG - Intronic
1061905338 9:133693802-133693824 CATCAGCGTGGGCCCTGAACTGG + Intronic
1062638008 9:137501563-137501585 CACCAGAGGAGGGCCTGGACTGG - Intronic
1203774689 EBV:66158-66180 CCACAAAGGGGGCCCTGTCCCGG - Intergenic
1191593335 X:62913098-62913120 CACTAAAGGGGGCACTAAAGAGG - Intergenic
1200651753 Y:5848453-5848475 CACCGAAGGGTGACCTGAGCAGG + Intergenic