ID: 952160948

View in Genome Browser
Species Human (GRCh38)
Location 3:30692402-30692424
Sequence CAACCCATGAAGGTAAAAAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952160948 Original CRISPR CAACCCATGAAGGTAAAAAG TGG (reversed) Exonic
901744860 1:11365650-11365672 CCACGCATCAAGGTAAACAGAGG - Intergenic
903294584 1:22335642-22335664 CAACCCAGACAGGTAAACAGTGG - Intergenic
903743080 1:25569539-25569561 AAACCCAGGGTGGTAAAAAGCGG - Intergenic
905487609 1:38314990-38315012 CACACCATGAAGGAAAAAAATGG - Intergenic
905501501 1:38443112-38443134 CATTCCAGGAAGGAAAAAAGAGG - Intergenic
906889682 1:49695516-49695538 GAACCCCTGTAGGTAAAGAGAGG + Intronic
909023271 1:70455551-70455573 AACCCCATGAAGATAAATAGGGG - Intergenic
909728511 1:78865757-78865779 CAATCCATGAAAGAAAAAACTGG - Intergenic
909880903 1:80876707-80876729 CAAACCATCAAGAAAAAAAGTGG + Intergenic
910315574 1:85879099-85879121 CAACCCATGAAAGAAAAAACTGG - Intronic
911564769 1:99450914-99450936 GAACTCATGAAGATAAAGAGTGG + Intergenic
914704722 1:150161192-150161214 CAACCCATGTAAGCAAAATGGGG + Intronic
915494911 1:156275265-156275287 CTGCCCATGAAGGAGAAAAGTGG + Intronic
917456668 1:175192051-175192073 CCACCCATGAAGGTAGAGTGGGG - Intronic
924123995 1:240830826-240830848 CAACCATTGAAGGCATAAAGTGG + Intronic
924469401 1:244326985-244327007 TAAACCATGAAGATAAAAGGAGG - Intergenic
1062891843 10:1068018-1068040 GAACACATGGAGGTAAACAGTGG + Intronic
1065894029 10:30145652-30145674 CAACCCATGAAGGGTAATTGTGG + Intergenic
1067347174 10:45445095-45445117 CAGCCCAGGAAGGCAGAAAGCGG - Intronic
1068619222 10:59160815-59160837 AAACCCACTAAGGTAAAAACTGG + Intergenic
1068984041 10:63090693-63090715 CAACCTATGCAGTCAAAAAGAGG + Intergenic
1070444864 10:76487423-76487445 TAACCCTTGAAGGTAAAGAAGGG + Intronic
1072231253 10:93415772-93415794 AAACCGATGAACGTATAAAGAGG - Intronic
1073677674 10:105666810-105666832 CAACCAATATAGGGAAAAAGGGG - Intergenic
1073902880 10:108244348-108244370 CAACCCTTGATGGTAATAGGGGG - Intergenic
1074526159 10:114265055-114265077 AAATACATGAAGATAAAAAGTGG + Intronic
1074685543 10:115959430-115959452 CAGCCCATGAAGGCTAAGAGAGG - Intergenic
1077085558 11:748039-748061 CGACCCATGAAGGTGCACAGAGG - Intronic
1078197615 11:9149454-9149476 CAACACATCATGGTGAAAAGGGG + Intronic
1078503820 11:11913152-11913174 CAACACAGTAAGGTAAGAAGAGG + Intronic
1079886526 11:25996650-25996672 CAACACATGAAGGTAAACTTGGG - Intergenic
1080197907 11:29633075-29633097 CCTCCCATGAAGGAAAAGAGAGG + Intergenic
1081372557 11:42321929-42321951 CTACCCATGGAGGTAATAAGTGG + Intergenic
1081559549 11:44200597-44200619 CAACCCAGGATGGTCAACAGGGG + Intronic
1085838836 11:79986714-79986736 CACCCCATGAAGTTAGAGAGAGG + Intergenic
1086556406 11:88116257-88116279 CCATTCAGGAAGGTAAAAAGGGG + Intronic
1087798761 11:102481667-102481689 CAAGCCAAGAAGTTAAAAAAAGG - Intronic
1089431393 11:118427623-118427645 CAGCTCAGGAAGGTAAAAGGGGG - Intronic
1089614331 11:119686781-119686803 CAATCCATGAAGGTGGGAAGAGG - Intronic
1090274256 11:125408589-125408611 CAACCCAGGAGAGTAAAAAAAGG + Intronic
1092506973 12:9112456-9112478 CAACCCAAGAATTTAAGAAGCGG - Exonic
1093642830 12:21547457-21547479 CAAGCCATGAAAATAAATAGAGG + Intronic
1093922862 12:24879160-24879182 CAAATCATGAAGGAAAAAAATGG + Intronic
1095608756 12:44102353-44102375 TAACCCATGTAGGTATGAAGAGG + Intronic
1097686336 12:62694383-62694405 CAACCCCTGAAGGTGAGAACTGG - Intronic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1099067359 12:77999340-77999362 AAACACATGAAATTAAAAAGTGG + Intronic
1103033548 12:117638070-117638092 CAAACCACTAAGATAAAAAGAGG + Intronic
1104328089 12:127819005-127819027 CAACCTCAGAAGGTATAAAGAGG + Intergenic
1105295204 13:19083021-19083043 CAATCCATGAAAGAAAAAATTGG + Intergenic
1106659939 13:31788651-31788673 AAAACCATGAAGGTAGCAAGAGG - Intronic
1107418872 13:40226951-40226973 TAAAACATGAAGGTAAAAGGTGG + Intergenic
1107605595 13:42052546-42052568 AAACTCAAGAAGGTAAAGAGGGG - Intronic
1109058995 13:57588704-57588726 CAATGCATGATGGAAAAAAGTGG - Intergenic
1110285833 13:73749169-73749191 CAATCCATGTTGGTATAAAGAGG - Intronic
1110879596 13:80555398-80555420 CTACCCAAGAAGGAAAAAGGGGG - Intergenic
1114255102 14:20994989-20995011 AAACCCATGAAGGAGAAAAATGG - Intronic
1114937474 14:27559731-27559753 CAACCCAGGAAGGGTTAAAGAGG - Intergenic
1115352936 14:32415617-32415639 CAAGCCATGAAGATAAATGGTGG - Intronic
1117053145 14:51882495-51882517 AAACCCTTGAAGGGTAAAAGGGG + Intronic
1119984033 14:79115430-79115452 CAAGTTATGAAGGTCAAAAGGGG - Intronic
1120406393 14:84098497-84098519 CAACCAATGAAGTTGAGAAGTGG + Intergenic
1122694646 14:103546764-103546786 CAACCCATGATGGTAGCAGGTGG + Intergenic
1125013751 15:34909210-34909232 CATGCCAAGAAGGTAAAAGGAGG + Intronic
1126332280 15:47546173-47546195 AAAACCATGGAAGTAAAAAGAGG + Intronic
1126978481 15:54213582-54213604 CAACCCATGAATGTACCCAGAGG - Intronic
1127239624 15:57098287-57098309 GAACACAAGAAGTTAAAAAGAGG - Intronic
1129368084 15:75069293-75069315 CCACCCATGAAGCTAAGCAGGGG - Intronic
1130418308 15:83714997-83715019 CAACCCATGAAGGTTACAGTGGG - Intronic
1130753483 15:86738559-86738581 AAACCCATGTAGTTAAAAATGGG - Intronic
1130897077 15:88179634-88179656 CACCCCATAAAGGGAAAGAGGGG + Intronic
1131096616 15:89659049-89659071 CAAACCACGAAGGGAAAGAGTGG + Intergenic
1131812446 15:96186511-96186533 CAAAACGTGAAGGCAAAAAGGGG + Intergenic
1134864169 16:17590107-17590129 CAAACCATGAGGGACAAAAGAGG + Intergenic
1135390005 16:22084376-22084398 AAAAACATGAAGGAAAAAAGTGG + Exonic
1139616846 16:68101050-68101072 CAATCCATGAAAGAAAAAATTGG - Intronic
1140329706 16:74042313-74042335 AAACCCATTAACGTAAAAATTGG + Intergenic
1141358028 16:83367164-83367186 AAATCCATGGAGGTAGAAAGTGG - Intronic
1141472339 16:84247479-84247501 CAACTCATGAAGGTGGAATGTGG + Intergenic
1141929482 16:87192403-87192425 AAACCCATCAAGGGAAAATGTGG + Intronic
1143924813 17:10360128-10360150 CAAGTCATGATGGTACAAAGAGG + Intronic
1144471481 17:15546142-15546164 CAACTCATGACAGTAAAGAGTGG + Intronic
1144924993 17:18798564-18798586 CAACTCATGACAGTAAAGAGTGG - Intronic
1145067822 17:19774086-19774108 CAACCCATGAATGTATGAACTGG + Exonic
1147196947 17:38773339-38773361 CATTCCCTGAAGGTCAAAAGAGG + Intronic
1149822698 17:59794927-59794949 CAACACAAGAAGGTAGAAATGGG - Intronic
1151981550 17:77513309-77513331 CAGGCTATGATGGTAAAAAGAGG + Intergenic
1203172316 17_GL000205v2_random:159452-159474 CAACACATGAAATTACAAAGGGG - Intergenic
1153758819 18:8310560-8310582 CAAACCATGAAGATGGAAAGTGG - Intronic
1155468678 18:26168030-26168052 AAACCCATGAAGGTAACTAACGG - Intronic
1156022018 18:32610390-32610412 CAACCCATTGAGATAAATAGTGG + Intergenic
1156623392 18:38880232-38880254 GAACATATGAAGGAAAAAAGAGG + Intergenic
1158287279 18:55897994-55898016 CAGGCCAAGAAGGTAAAATGTGG - Intergenic
1158815559 18:61091120-61091142 CAACCCATGAATGAAAGAATTGG - Intergenic
1159551212 18:69897366-69897388 TAACCCAGCAAGGTAACAAGTGG + Intronic
1161402228 19:4071942-4071964 CAATCCATGGAGATACAAAGTGG + Intergenic
1164503534 19:28839518-28839540 CACCCCATGAAGATAAAATGAGG - Intergenic
1166002957 19:39889235-39889257 CAATGCATGGAGGTAAAGAGAGG + Intronic
1166005744 19:39905487-39905509 CAATGCATGGAGGTAAAGAGAGG + Intronic
924961699 2:41188-41210 CAGCCCAGGATGGTCAAAAGGGG + Exonic
928580692 2:32704695-32704717 AAACCCATCAAGGTCAAAAAAGG - Intronic
928912871 2:36440471-36440493 CAACCCAAGAAGCTAAACTGTGG + Intronic
929805708 2:45143214-45143236 GAAACCATGCAGGTCAAAAGTGG + Intergenic
930182304 2:48373714-48373736 AAATCCATGAAGGAAAAAAATGG + Intronic
933145515 2:78847158-78847180 CAACTCATGAAGCTAAAATTTGG - Intergenic
935035510 2:99368535-99368557 CAATTTATGAAGATAAAAAGAGG + Exonic
937442122 2:121925351-121925373 CAACCCTTGAAGGAAAAAAAAGG - Intergenic
938817036 2:134915436-134915458 CAATCCATGAAAGAAAAAACTGG - Intergenic
939313363 2:140513734-140513756 CAACCCCTGAAATTTAAAAGAGG + Intronic
940995747 2:160147942-160147964 CAATCCATGAAAGAAAAAATTGG + Intronic
941781555 2:169451094-169451116 CAATCCATGAAAGAAAAAAGTGG - Intergenic
943445885 2:187987502-187987524 TAACTCATGAAAATAAAAAGTGG - Intergenic
943680729 2:190764870-190764892 CAACACAAAAATGTAAAAAGTGG + Intergenic
943922152 2:193722860-193722882 CAACACATGAGGGCAAAGAGAGG + Intergenic
944877904 2:203981680-203981702 CAGCCCATGAAGGTGAGAATAGG + Intergenic
947439996 2:230111145-230111167 GAACACATGGAGGTAAAGAGTGG + Intergenic
948741240 2:240047488-240047510 CGACCCGTGAAGGTACAAGGTGG + Intergenic
1169543925 20:6631268-6631290 GACCCCATGAAGGTAAACAAAGG - Intergenic
1170057433 20:12222183-12222205 GAATCCAAGAAGGTAGAAAGAGG + Intergenic
1171003059 20:21434103-21434125 CACCCCATGTATGTAAAAAAGGG - Intergenic
1172696662 20:36827822-36827844 CAACCCTTGATAGTGAAAAGGGG - Intronic
1173256197 20:41395711-41395733 CATCCCATGAGGGAAGAAAGAGG - Intergenic
1173960239 20:47065377-47065399 CATCCCAAGAGGGGAAAAAGTGG + Intronic
1175706527 20:61182423-61182445 CAGCCCATGAATTTAAAATGAGG + Intergenic
1176273687 20:64250501-64250523 CAATCCGTGAAAGTAAAAATTGG - Intergenic
1176328304 21:5521289-5521311 CAACACATGAAATTACAAAGGGG - Intergenic
1176399453 21:6299662-6299684 CAACACATGAAATTACAAAGGGG + Intergenic
1176437704 21:6689442-6689464 CAACACATGAAATTACAAAGGGG - Intergenic
1176461966 21:7016512-7016534 CAACACATGAAATTACAAAGGGG - Intergenic
1176485527 21:7398290-7398312 CAACACATGAAATTACAAAGGGG - Intergenic
1178036941 21:28595365-28595387 GAACCCATGAAGATAGAGAGTGG - Intergenic
1184244629 22:43229702-43229724 CCACCCATAAAGGTCAAAAAGGG + Intronic
1184475563 22:44719445-44719467 AAAGCCATCAAGATAAAAAGAGG - Intronic
951224377 3:20104189-20104211 CAACAGCTGAAGGCAAAAAGTGG + Intronic
951662225 3:25080893-25080915 CAAGCAATGAAAGTAAAAATAGG - Intergenic
952160948 3:30692402-30692424 CAACCCATGAAGGTAAAAAGTGG - Exonic
952185697 3:30966104-30966126 CAGCCCATGAAGACAAAAAATGG + Intergenic
953352839 3:42229083-42229105 CAGCCCAGGAAGTTCAAAAGAGG + Intergenic
954942179 3:54383847-54383869 CAACACAAGAAGGTAAACACTGG - Intronic
959225090 3:103570557-103570579 AGTCCCATGTAGGTAAAAAGAGG + Intergenic
959307586 3:104688889-104688911 CAAACCATGTAGATAAAAAATGG - Intergenic
959346436 3:105200985-105201007 GAAGCCATCAATGTAAAAAGAGG + Intergenic
959665157 3:108912148-108912170 CAAACGGTGAAGGTGAAAAGAGG - Intronic
960812839 3:121641755-121641777 CAACCCATTAGAGAAAAAAGAGG + Intronic
961113055 3:124301636-124301658 CATCCCAAGCAGGTGAAAAGAGG + Intronic
961146046 3:124594136-124594158 GAACCCATTTAAGTAAAAAGCGG - Intronic
962860984 3:139401224-139401246 GAACCCATGAATGCAAAAAAGGG - Intergenic
964703834 3:159597467-159597489 GATCACATGTAGGTAAAAAGTGG - Intronic
966304695 3:178518215-178518237 CTACCCAGGAAGGTCAAAAAGGG + Intronic
966336443 3:178873209-178873231 CAACCCATGAAGCCTATAAGTGG + Intergenic
967115779 3:186336528-186336550 CAACTCAAGAAGCTAAAAAAGGG + Intronic
971592726 4:28489072-28489094 CAAGCCATGAACATACAAAGGGG - Intergenic
974105363 4:57463748-57463770 CAACCCATCAAGGCAAATATTGG - Intergenic
974466255 4:62260168-62260190 GATCCACTGAAGGTAAAAAGTGG + Intergenic
976240831 4:82954965-82954987 CAATCCATGAAAGAAAAAACTGG + Intronic
976851626 4:89553591-89553613 GAACTCATGAAGATAAAGAGGGG - Intergenic
977239611 4:94551774-94551796 TGACCCATAAAGGAAAAAAGTGG + Intronic
977814696 4:101401387-101401409 CAACCCATAAATGTAGGAAGTGG - Intergenic
978334787 4:107654839-107654861 CGACTCATGAAGATAAAGAGAGG - Exonic
978820645 4:112960812-112960834 GATGTCATGAAGGTAAAAAGGGG - Intronic
979648001 4:123094324-123094346 CAAGCCATGATGGGAAATAGGGG - Intronic
983801698 4:171938671-171938693 CAACCCATGAATCTAAACATTGG - Intronic
983874308 4:172858493-172858515 CAACCCATGCAACTAACAAGAGG + Intronic
984836403 4:184026037-184026059 TAACACATGAAGGAAAAAAGAGG - Intergenic
985642263 5:1069237-1069259 GATCCCATGGAGGTAAAAAATGG - Intronic
988169189 5:27632723-27632745 CAACCCATCTAGCTATAAAGTGG - Intergenic
991678738 5:69116468-69116490 TCACCCATGAAGTTATAAAGAGG - Exonic
992834460 5:80626396-80626418 AAACCCATGAAGGTAACTAACGG - Exonic
995865657 5:116687457-116687479 CAACCAATTAAGGAAAAATGTGG + Intergenic
996419660 5:123248503-123248525 CAACCCATCATGGGAAGAAGGGG - Intergenic
996459824 5:123728951-123728973 CAGACTATGAAGATAAAAAGGGG + Intergenic
996828986 5:127719081-127719103 GAATCCATGGAGATAAAAAGTGG - Intergenic
997925343 5:138025647-138025669 CAGCCCATGGGGGGAAAAAGGGG - Intronic
998225584 5:140323821-140323843 AGACCCATGATGGTAAAAACTGG + Intergenic
999500304 5:152140487-152140509 CAACCCATGAAAGATAAAAGGGG + Intergenic
999612862 5:153389439-153389461 CAACCCATGAAAGGATAAATTGG - Intergenic
1000638227 5:163668201-163668223 GATCTCATGAAGGTAGAAAGTGG + Intergenic
1001296109 5:170500225-170500247 GAACTAATGAAGGTTAAAAGAGG - Intronic
1001505468 5:172275963-172275985 GAACCCATGAGGGAAAAAAATGG - Intronic
1002615395 5:180451305-180451327 AAGCCCATGAAGAGAAAAAGCGG - Intergenic
1004742805 6:18478785-18478807 CAACTCAGGAAGTTAAAAAAAGG - Intergenic
1005523496 6:26622608-26622630 CAATCCATAAAAGTAAAAATTGG - Intergenic
1007661158 6:43487352-43487374 CTACCTGTGAAGGTATAAAGAGG - Intronic
1007980665 6:46153398-46153420 CAACCCATAAAAGGAAAAATTGG - Intergenic
1010495401 6:76529086-76529108 CTAACCAGGAAGGTGAAAAGAGG - Intergenic
1010757658 6:79685097-79685119 CAACTCAGGAAGGTGAAAATAGG - Intronic
1011735296 6:90304050-90304072 CAAACCCTGAGGGTAAAAAAAGG - Intergenic
1011841234 6:91501629-91501651 CAAACCCTGATGATAAAAAGTGG - Intergenic
1017553410 6:155536591-155536613 CAACTCAAGAAGTTAGAAAGAGG + Intergenic
1019363623 7:618913-618935 CAAACCATAAAGCAAAAAAGAGG - Intronic
1020962973 7:14829122-14829144 CTACCCATGAAGGTAAAGATTGG - Intronic
1023516313 7:41005372-41005394 CCACCCATGAGGGATAAAAGAGG + Intergenic
1023647677 7:42336235-42336257 CTACCCATGATATTAAAAAGAGG - Intergenic
1024669387 7:51578214-51578236 CAAGCAATGAAAGAAAAAAGTGG - Intergenic
1025831152 7:65051340-65051362 CAACCCAGAAAGGGAAAAAATGG - Intergenic
1025918301 7:65885221-65885243 CAACCCAGAAAGGGAAAAAATGG - Intronic
1028826140 7:95275699-95275721 CAACCCATGAAGTGGAGAAGTGG - Intronic
1028938860 7:96496842-96496864 AAACCCATGAAGGGAAATTGAGG - Intronic
1031545341 7:123045373-123045395 CATCCCATGAAGGAAGAAGGAGG - Intergenic
1037052587 8:14394775-14394797 AAAATCATGAAGGTAAAAAAAGG + Intronic
1038040938 8:23723374-23723396 CAACCTATGAAGGAAAAGACTGG + Intergenic
1038139895 8:24833064-24833086 CAGATCATGAAGGTCAAAAGAGG + Intergenic
1039601565 8:38842611-38842633 CAACCAAAGAAGGAAAAATGTGG - Intronic
1039627601 8:39070421-39070443 TAGCAAATGAAGGTAAAAAGTGG - Intronic
1040275312 8:46010795-46010817 CAACTCTTGAAGGAAAAAAAGGG - Intergenic
1041793839 8:61725584-61725606 TACCCCATTAAGGTAAAAATTGG + Intergenic
1044313449 8:90722920-90722942 CAACTCCTGAAGGTCAAAACAGG - Intronic
1046674944 8:117097027-117097049 CACTCCATGAAGGCAAAAATGGG - Intronic
1046908046 8:119595492-119595514 CAACCCTGCAAGGTAAAAGGAGG - Intronic
1047625222 8:126649369-126649391 CCACCCATGAAGGTGGGAAGTGG - Intergenic
1051575757 9:18613683-18613705 GAACACATGAAGACAAAAAGGGG + Intronic
1052194741 9:25697803-25697825 CAAACCATGACGTTCAAAAGAGG - Intergenic
1203432707 Un_GL000195v1:105384-105406 CAACTCATGAAATTACAAAGGGG - Intergenic
1203433799 Un_GL000195v1:119180-119202 CAACACATGAAATTACAAAGGGG + Intergenic
1191749718 X:64528736-64528758 CTATCCATGGAGGCAAAAAGAGG + Intergenic
1195016119 X:100783061-100783083 CAATCCATGAAAGAAAAAATTGG - Intergenic
1195627415 X:107018638-107018660 CAACTCATGAAGGAAAGAAGGGG + Intergenic
1198059501 X:133031212-133031234 CAACCCATGAATGCAGTAAGTGG + Intronic
1199478314 X:148270592-148270614 CAACCTATGAAGGATAAAAGCGG - Intergenic
1200753265 Y:6966462-6966484 CAACCCTTTCAGGCAAAAAGAGG - Intronic
1201592580 Y:15631564-15631586 AAACCCATGAAAGTAAAAGTTGG - Intergenic