ID: 952162750

View in Genome Browser
Species Human (GRCh38)
Location 3:30710783-30710805
Sequence AGAGAAGAATCTGAACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952162750_952162757 28 Left 952162750 3:30710783-30710805 CCTGTTTGTTCAGATTCTTCTCT No data
Right 952162757 3:30710834-30710856 TCCTTCCTCTGGGCATAGGAAGG No data
952162750_952162759 29 Left 952162750 3:30710783-30710805 CCTGTTTGTTCAGATTCTTCTCT No data
Right 952162759 3:30710835-30710857 CCTTCCTCTGGGCATAGGAAGGG No data
952162750_952162751 1 Left 952162750 3:30710783-30710805 CCTGTTTGTTCAGATTCTTCTCT No data
Right 952162751 3:30710807-30710829 TCCCTGTGTCTTCAGAGATAAGG No data
952162750_952162754 17 Left 952162750 3:30710783-30710805 CCTGTTTGTTCAGATTCTTCTCT No data
Right 952162754 3:30710823-30710845 GATAAGGATGTTCCTTCCTCTGG No data
952162750_952162756 24 Left 952162750 3:30710783-30710805 CCTGTTTGTTCAGATTCTTCTCT No data
Right 952162756 3:30710830-30710852 ATGTTCCTTCCTCTGGGCATAGG No data
952162750_952162755 18 Left 952162750 3:30710783-30710805 CCTGTTTGTTCAGATTCTTCTCT No data
Right 952162755 3:30710824-30710846 ATAAGGATGTTCCTTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952162750 Original CRISPR AGAGAAGAATCTGAACAAAC AGG (reversed) Intergenic