ID: 952162752

View in Genome Browser
Species Human (GRCh38)
Location 3:30710808-30710830
Sequence TCCTTATCTCTGAAGACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952162752_952162754 -8 Left 952162752 3:30710808-30710830 CCCTGTGTCTTCAGAGATAAGGA No data
Right 952162754 3:30710823-30710845 GATAAGGATGTTCCTTCCTCTGG No data
952162752_952162755 -7 Left 952162752 3:30710808-30710830 CCCTGTGTCTTCAGAGATAAGGA No data
Right 952162755 3:30710824-30710846 ATAAGGATGTTCCTTCCTCTGGG No data
952162752_952162756 -1 Left 952162752 3:30710808-30710830 CCCTGTGTCTTCAGAGATAAGGA No data
Right 952162756 3:30710830-30710852 ATGTTCCTTCCTCTGGGCATAGG No data
952162752_952162761 17 Left 952162752 3:30710808-30710830 CCCTGTGTCTTCAGAGATAAGGA No data
Right 952162761 3:30710848-30710870 ATAGGAAGGGTACCTCTCTGAGG No data
952162752_952162762 18 Left 952162752 3:30710808-30710830 CCCTGTGTCTTCAGAGATAAGGA No data
Right 952162762 3:30710849-30710871 TAGGAAGGGTACCTCTCTGAGGG No data
952162752_952162757 3 Left 952162752 3:30710808-30710830 CCCTGTGTCTTCAGAGATAAGGA No data
Right 952162757 3:30710834-30710856 TCCTTCCTCTGGGCATAGGAAGG No data
952162752_952162759 4 Left 952162752 3:30710808-30710830 CCCTGTGTCTTCAGAGATAAGGA No data
Right 952162759 3:30710835-30710857 CCTTCCTCTGGGCATAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952162752 Original CRISPR TCCTTATCTCTGAAGACACA GGG (reversed) Intergenic