ID: 952162755

View in Genome Browser
Species Human (GRCh38)
Location 3:30710824-30710846
Sequence ATAAGGATGTTCCTTCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952162752_952162755 -7 Left 952162752 3:30710808-30710830 CCCTGTGTCTTCAGAGATAAGGA No data
Right 952162755 3:30710824-30710846 ATAAGGATGTTCCTTCCTCTGGG No data
952162750_952162755 18 Left 952162750 3:30710783-30710805 CCTGTTTGTTCAGATTCTTCTCT No data
Right 952162755 3:30710824-30710846 ATAAGGATGTTCCTTCCTCTGGG No data
952162753_952162755 -8 Left 952162753 3:30710809-30710831 CCTGTGTCTTCAGAGATAAGGAT No data
Right 952162755 3:30710824-30710846 ATAAGGATGTTCCTTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952162755 Original CRISPR ATAAGGATGTTCCTTCCTCT GGG Intergenic