ID: 952163924

View in Genome Browser
Species Human (GRCh38)
Location 3:30725044-30725066
Sequence GCAGGAACAGTGGTTTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952163924_952163929 23 Left 952163924 3:30725044-30725066 CCAGGCAAAACCACTGTTCCTGC No data
Right 952163929 3:30725090-30725112 ACTCCTTTATAATGGTTGCCCGG No data
952163924_952163930 24 Left 952163924 3:30725044-30725066 CCAGGCAAAACCACTGTTCCTGC No data
Right 952163930 3:30725091-30725113 CTCCTTTATAATGGTTGCCCGGG No data
952163924_952163928 15 Left 952163924 3:30725044-30725066 CCAGGCAAAACCACTGTTCCTGC No data
Right 952163928 3:30725082-30725104 AAATGGCAACTCCTTTATAATGG No data
952163924_952163927 -2 Left 952163924 3:30725044-30725066 CCAGGCAAAACCACTGTTCCTGC No data
Right 952163927 3:30725065-30725087 GCAATCTTCAACTCAGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952163924 Original CRISPR GCAGGAACAGTGGTTTTGCC TGG (reversed) Intergenic