ID: 952168354

View in Genome Browser
Species Human (GRCh38)
Location 3:30776722-30776744
Sequence CAGTCTAACTAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952168354_952168360 6 Left 952168354 3:30776722-30776744 CCCTCTTCCTTCTAGTTAGACTG 0: 1
1: 0
2: 0
3: 17
4: 213
Right 952168360 3:30776751-30776773 AAATCCCAAGCTTTCTGCCGTGG 0: 1
1: 0
2: 1
3: 6
4: 102
952168354_952168362 10 Left 952168354 3:30776722-30776744 CCCTCTTCCTTCTAGTTAGACTG 0: 1
1: 0
2: 0
3: 17
4: 213
Right 952168362 3:30776755-30776777 CCCAAGCTTTCTGCCGTGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 99
952168354_952168364 15 Left 952168354 3:30776722-30776744 CCCTCTTCCTTCTAGTTAGACTG 0: 1
1: 0
2: 0
3: 17
4: 213
Right 952168364 3:30776760-30776782 GCTTTCTGCCGTGGAAGGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952168354 Original CRISPR CAGTCTAACTAGAAGGAAGA GGG (reversed) Intronic
900762840 1:4484292-4484314 CAGCCCAACTAGTAGGAAAATGG - Intergenic
901232703 1:7650073-7650095 CAGTCTTACCAGGAGCAAGATGG + Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
905288981 1:36908401-36908423 CAGGCTCTCTAGAAGGGAGAGGG - Intronic
907971810 1:59390462-59390484 CAGTCCATGTAGCAGGAAGAAGG + Intronic
910916589 1:92296243-92296265 GTGTGTACCTAGAAGGAAGATGG + Intronic
917349409 1:174061708-174061730 CTGTCTAAAAAGAAGAAAGAAGG - Intergenic
917787269 1:178472203-178472225 CAGTCTAACTAAAGGAAAGTAGG - Intronic
917895236 1:179480728-179480750 GAGTCTTAATACAAGGAAGAGGG - Intronic
918978316 1:191520690-191520712 CTTTCTCTCTAGAAGGAAGAAGG - Intergenic
919076189 1:192815882-192815904 CAGTCTAAATCGAAGGAAAGGGG + Intergenic
921634070 1:217471635-217471657 CTTTCTAACTTGATGGAAGAGGG + Intronic
922930358 1:229384194-229384216 CACTCTAGCCAGAAGGAAGGAGG - Intergenic
1065707765 10:28486889-28486911 TAGTCTGACTAGAATGAAGTAGG - Intergenic
1066017663 10:31264210-31264232 CAGTCAATCCACAAGGAAGAGGG - Intergenic
1066617370 10:37308878-37308900 ATGTCAAACTAGAAGGAAGGAGG + Intronic
1066754697 10:38699517-38699539 CAGACTTACTAGAACTAAGAGGG + Intergenic
1067797371 10:49330493-49330515 GAGTCCACCTAGAAGTAAGAGGG - Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069814712 10:71186544-71186566 TAGTCAAACTAGAAGGCAGGGGG - Intergenic
1072531033 10:96319542-96319564 CAGTCTCGATAGAAAGAAGAAGG - Intronic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1076055919 10:127372820-127372842 CACTCTAAACTGAAGGAAGATGG - Intronic
1076499821 10:130928792-130928814 AAGTCTTTCTAGAAGGAAGAAGG - Intergenic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078925496 11:15871141-15871163 AAGTCTAATTAGCAGGAAGTAGG + Intergenic
1079659501 11:23021006-23021028 CAGACAACCCAGAAGGAAGAAGG - Intergenic
1079794625 11:24785066-24785088 TAGTGTAACTACAGGGAAGAAGG - Intronic
1079950001 11:26790255-26790277 AAGTCTAGGTAGAAAGAAGATGG + Intergenic
1079953994 11:26840434-26840456 GAGTATAACTAGAAGCCAGAGGG - Intergenic
1080254944 11:30280256-30280278 CAGTCTGAGTAGAAGAAAAAGGG - Intergenic
1080691657 11:34563767-34563789 GAGTCTAACTGGAAGCCAGAGGG + Intergenic
1080813764 11:35733563-35733585 CACTCCAACTAGAGGGAAGTAGG - Intronic
1081577577 11:44328684-44328706 GACACTAACTAGAAGGCAGAGGG + Intergenic
1083181119 11:60986307-60986329 CAGTCTCACCAGCAGGAAGGTGG + Intronic
1083336074 11:61922637-61922659 GAGGCTAACCAGAAAGAAGAGGG - Intergenic
1084586476 11:70065575-70065597 CAGGCCAACTAGAGGGACGACGG - Intergenic
1084994251 11:72959930-72959952 CAGTCTAACTTTGAGGAAGATGG + Intronic
1085554207 11:77404667-77404689 CATTGTAACTGGAAGGAAGAAGG - Intronic
1087504909 11:99007345-99007367 CAGCCTTAATAGAAGGAAGATGG - Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1090083800 11:123633364-123633386 AAGTCTTAATAGAAGGAAGCAGG - Exonic
1091653592 12:2327715-2327737 CAGCGTAATTACAAGGAAGATGG + Intronic
1092079295 12:5700867-5700889 GATTCAAACTAGAAGGAAGATGG - Intronic
1094236977 12:28178997-28179019 CATTCTAACTAGCAGGAAAAGGG - Intronic
1094270360 12:28607955-28607977 CAGTCTAACAAGATGGAAAAAGG - Intergenic
1094441174 12:30478661-30478683 AATTCTCCCTAGAAGGAAGAGGG + Intergenic
1094452592 12:30598358-30598380 CTGTCTAGCCAGAAGGGAGATGG - Intergenic
1095644704 12:44529801-44529823 AAGTGTCACTGGAAGGAAGAAGG + Intronic
1097298188 12:57989753-57989775 CAGTGTAACAGGCAGGAAGATGG + Intergenic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101932974 12:109030064-109030086 CAGCGTAACTTGCAGGAAGAAGG - Intronic
1102478254 12:113202665-113202687 CAGTCTAGCCAGCAGGAAGGAGG - Intronic
1107276429 13:38685738-38685760 CAGTCTAAATTGAAGCTAGAAGG - Intergenic
1108858712 13:54827785-54827807 CAGACTAACTAAAAGAAAAAAGG + Intergenic
1109685085 13:65808388-65808410 CTGTCTACCTAGAAATAAGATGG - Intergenic
1109772784 13:66998648-66998670 CTGGCTAACTATGAGGAAGAGGG - Intronic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1110485010 13:76029050-76029072 TGGATTAACTAGAAGGAAGATGG + Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112862955 13:103857088-103857110 CAGTCTACCTGGAGGGAACAGGG + Intergenic
1114673324 14:24425441-24425463 CAGCCTAACAGGAAGGAGGAAGG - Intergenic
1116262188 14:42644579-42644601 CATTCTAAATAGCATGAAGACGG + Intergenic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1121057404 14:90869927-90869949 CAGTCAGACTAACAGGAAGAAGG - Exonic
1121095537 14:91215768-91215790 AAGTCAAACTAGAAGGAAAATGG - Intronic
1121666852 14:95679057-95679079 CAGTGTAACTGAAAGGAACAAGG - Intergenic
1122697886 14:103566095-103566117 AACTCTAACCAGAAAGAAGATGG - Intronic
1124438463 15:29670300-29670322 CACTCTGCCTAGAAGTAAGATGG + Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1125419142 15:39486789-39486811 AAGACTAAGTAGAAGGAATACGG - Intergenic
1127284522 15:57520837-57520859 CAGCTTAACCAGAAGGAAGTTGG - Intronic
1128593741 15:68926266-68926288 CATTCTAACTGGAGGGATGATGG + Intronic
1129107987 15:73322415-73322437 CAGTTAAACCTGAAGGAAGAAGG + Exonic
1130033691 15:80339414-80339436 CTGTCTACTTGGAAGGAAGAAGG + Intergenic
1130763096 15:86841174-86841196 CCCTTTAACTAGAAGAAAGATGG + Intronic
1133893310 16:9902317-9902339 CATTGCAACTAGAAGGAAGGAGG - Intronic
1134022282 16:10929556-10929578 AGGTCTAACAAGAAGGAAAAAGG + Exonic
1136548368 16:30967913-30967935 CAGGCAAACTAGGAGGAAGGTGG - Intronic
1136727989 16:32377331-32377353 CAGACTTACTAGAACTAAGAGGG - Intergenic
1202998449 16_KI270728v1_random:140423-140445 CAGACTTACTAGAACTAAGAGGG + Intergenic
1203130043 16_KI270728v1_random:1676827-1676849 CAGACTTACTAGAACTAAGAGGG + Intergenic
1143045185 17:4072573-4072595 CAGTCTAAATAGAAAGAAAACGG + Intronic
1144038951 17:11391429-11391451 AAGTGTAACAAGGAGGAAGAGGG - Intronic
1147031580 17:37642146-37642168 GAGCCTAACTGAAAGGAAGAGGG - Exonic
1151349708 17:73524566-73524588 CAGTCATGCTAGAGGGAAGAGGG - Intronic
1151927944 17:77212542-77212564 CACCCTAAATAGAAGTAAGAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156197845 18:34795792-34795814 CAGACTAACAATAAGGAAGGGGG + Intronic
1157044873 18:44089425-44089447 CATTCTAGCTACATGGAAGATGG - Intergenic
1157486469 18:48090795-48090817 CAGTGGAACTGGAAGGTAGATGG - Intronic
1158897721 18:61930875-61930897 CAGTAGAAATAGAAGCAAGATGG + Intergenic
1160057381 18:75496291-75496313 CAGCCTAAGAAGCAGGAAGATGG + Intergenic
1164298132 19:23934555-23934577 CAGTCTTTCTAGAATCAAGAAGG + Intronic
1164662060 19:29983292-29983314 AAGACAAAGTAGAAGGAAGATGG - Intronic
926091533 2:10053710-10053732 CAGTCTACCTAGAAAATAGATGG + Exonic
926790236 2:16563409-16563431 CAGTATATCTTGAATGAAGAAGG - Intronic
927186358 2:20485294-20485316 CAGCCCAGGTAGAAGGAAGATGG - Intergenic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
929588040 2:43128227-43128249 CAGTCTAGGTAGAGAGAAGAAGG + Intergenic
933006182 2:76998320-76998342 CAGTCTAACTAGAGAGCTGAGGG + Intronic
933006265 2:76999256-76999278 CAGTCTAACTAGAGAGCTGAGGG - Intronic
933231505 2:79813002-79813024 CAGTCTAACTAGTGGTAACAAGG - Intronic
933277594 2:80300595-80300617 AAGTCCAAATAGCAGGAAGAGGG - Intronic
934301405 2:91778728-91778750 CTGTCTAACTACAAGGTGGAAGG + Intergenic
934317981 2:91943752-91943774 CAGACTTACTAGAACTAAGAGGG + Intergenic
935120521 2:100180000-100180022 CCCTCTAACCAGAAGGCAGAGGG - Intergenic
937524501 2:122751108-122751130 AAGTCTAACTAGGAATAAGAAGG - Intergenic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
940048704 2:149437813-149437835 CAGTCTTACTTGAAGGATGGAGG - Exonic
940950594 2:159668677-159668699 TAAACTAAGTAGAAGGAAGAAGG - Intergenic
941439435 2:165514856-165514878 AAGTCTACCGAAAAGGAAGAAGG - Intronic
941952212 2:171167273-171167295 CACTCTGATAAGAAGGAAGAAGG - Intronic
944098342 2:195994933-195994955 CTGTCTAAAGAAAAGGAAGAAGG - Intronic
946606930 2:221415622-221415644 CAGTCTCCCTAGGAGGAAGGAGG - Intergenic
1170758729 20:19230357-19230379 TATTCTAACTACAAGGTAGAAGG - Intronic
1178387798 21:32168839-32168861 GAGTATAACTAGTAGGATGATGG + Intergenic
1178851877 21:36219351-36219373 CCCTGTAATTAGAAGGAAGATGG - Exonic
1178933762 21:36842865-36842887 CAGCCTAACCAGCAGGATGAGGG + Intronic
1179455715 21:41498473-41498495 CAGCCTGACCAGAAAGAAGAAGG + Intronic
1180306153 22:11127424-11127446 CAGACTTACTAGAACTAAGAGGG + Intergenic
1180544672 22:16489607-16489629 CAGACTTACTAGAACTAAGAGGG + Intergenic
1180815032 22:18783994-18784016 CTGTCTAACTACAAGGTGGAAGG - Intergenic
1181201220 22:21218331-21218353 CTGTCTAACTACAAGGTGGAAGG - Intronic
1181700523 22:24618636-24618658 CTGTCTAACTACAAGGTGGAAGG + Intronic
1182437942 22:30342560-30342582 CACTCTAGCTAGAAGACAGAAGG - Intronic
1185274341 22:49943885-49943907 CACGCTACCCAGAAGGAAGAAGG + Intergenic
1203225693 22_KI270731v1_random:77100-77122 CTGTCTAACTACAAGGTGGAAGG + Intergenic
1203265135 22_KI270734v1_random:9684-9706 CTGTCTAACTACAAGGTGGAAGG - Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
956571078 3:70695837-70695859 ATGTCTGACTAGAAGGCAGAAGG + Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
960203393 3:114865737-114865759 CAGTATAATTTGAAGGAAAAAGG + Intronic
960558841 3:119059591-119059613 CAGTACAACTAGAAGGGAAAGGG + Intronic
960701989 3:120448682-120448704 CAGGCAAACTACAGGGAAGAAGG - Intronic
963171522 3:142256234-142256256 CAAACCAACTAGAAGTAAGATGG + Intergenic
963681669 3:148385809-148385831 AAGTTTAATTAGAAGCAAGATGG - Intergenic
966748743 3:183302484-183302506 AAGACTAACTAGAGGAAAGAGGG + Intronic
967230423 3:187332636-187332658 CATTTTAACTGGAAGGCAGAGGG - Intergenic
967431373 3:189389887-189389909 CTGTCTACCTAGAAGGAAGTAGG + Intergenic
968223972 3:196961025-196961047 CAGTCAAAGCAGCAGGAAGATGG - Intronic
969451263 4:7274828-7274850 CAGGCTGACTTGAAGGGAGATGG + Intronic
971189609 4:24414817-24414839 CATTCCAGCAAGAAGGAAGAAGG - Intergenic
971659161 4:29389810-29389832 CTGTGTAGCTAGAAGCAAGATGG - Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
973727481 4:53790582-53790604 CAGTCTTAATAGGAGTAAGATGG + Intronic
974361731 4:60889707-60889729 TAGTCAAACAAGATGGAAGAAGG + Intergenic
975695416 4:77008074-77008096 CAGGCTAGCTAGAAGGAGGCAGG + Intronic
976043225 4:80912926-80912948 CACTCTAAAGAGAAGAAAGAGGG + Intronic
976136375 4:81941286-81941308 GATCCTAATTAGAAGGAAGAAGG + Intronic
976895430 4:90104304-90104326 CAGTCAAACGAGAAGGAACATGG + Intergenic
977247596 4:94651609-94651631 CAGTCTAACCAGAGGCAAGTGGG - Intronic
977868165 4:102056162-102056184 CAGTCTCACCAGTAGGATGAGGG - Intronic
977950462 4:102965033-102965055 CAGACTTACTAGAACTAAGAGGG + Intronic
979477458 4:121174915-121174937 CAATCAAACTAGAAACAAGAAGG + Intronic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
980110242 4:128629201-128629223 GATTCAAACTAGAAGGAAGATGG + Intergenic
980762735 4:137256941-137256963 CAGTATATCAGGAAGGAAGATGG + Intergenic
981051252 4:140311597-140311619 CAGGCTTACCAGGAGGAAGAGGG - Intronic
981324676 4:143432165-143432187 CTGTCTAACTCGAAAAAAGAAGG + Intronic
982482571 4:155930120-155930142 AAGTCTAGCTTAAAGGAAGATGG + Intronic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
987690931 5:21265878-21265900 CAGCCTTATGAGAAGGAAGAAGG + Intergenic
987875767 5:23678706-23678728 CAGTCTAAGTCCAAGAAAGAGGG + Intergenic
988006870 5:25424725-25424747 CAGTATTGCTAGAAGGAAAATGG + Intergenic
988047631 5:25977965-25977987 CAGTCTAACTAAAGTGGAGATGG + Intergenic
989412795 5:41139908-41139930 CAGTCTGACTAGGGAGAAGATGG - Intergenic
989604430 5:43230336-43230358 CATTCTAGCTAGCAGGAAGATGG + Intronic
993075445 5:83225065-83225087 CAGTCTAACAAGAAGGAGAGAGG - Intronic
993918268 5:93768397-93768419 CACTCTAAATAAAAGGAAGTGGG + Intronic
994114572 5:96047877-96047899 AAGTCTGATTTGAAGGAAGAAGG + Intergenic
995046424 5:107653613-107653635 TATTTTAACTAGAGGGAAGAGGG + Intronic
995144320 5:108769320-108769342 CATTCTCATTAGAAGGAATATGG + Intronic
995530846 5:113090640-113090662 CAGTCTACCCAGAAGGACGATGG + Intronic
997998710 5:138607025-138607047 AAGACTACCTAGAAGGCAGAGGG + Intergenic
1000871907 5:166587769-166587791 CAGTCAAACAAGTAAGAAGAGGG + Intergenic
1002391780 5:178919306-178919328 GAGTATAACTAGCACGAAGAAGG - Intronic
1003079933 6:3013806-3013828 CTGTCCAACTAGAAGGAAAGGGG + Intronic
1004182952 6:13396648-13396670 CACTCTTACAAGAAGGAAGCAGG + Intronic
1005414035 6:25582610-25582632 TAGCCTAGCAAGAAGGAAGAGGG - Intronic
1007396564 6:41581350-41581372 CGGTCTGACTGGAAGGAACAGGG - Intronic
1009868559 6:69428573-69428595 CCCTATAACTAGAAGGAAGAAGG + Intergenic
1012160059 6:95873440-95873462 CAGTCTATGTACCAGGAAGAAGG + Intergenic
1012501587 6:99894578-99894600 CACTCTAACTAAAAGGGAGATGG - Intergenic
1014215404 6:118748161-118748183 CAGTCAAATGAGAAGAAAGAAGG - Intergenic
1014681413 6:124435160-124435182 CTGGATAACTAGAAGGAATATGG + Intronic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1016407212 6:143743190-143743212 CAGTCTAAATTCTAGGAAGAAGG + Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018251120 6:161871616-161871638 CTGTCCAACTGCAAGGAAGAGGG - Intronic
1018614431 6:165673180-165673202 CAGATAAACTAGATGGAAGAAGG + Intronic
1020466814 7:8489284-8489306 CAGACTCCCTAGAATGAAGAAGG - Intronic
1021256797 7:18402197-18402219 TAGTCTAACCAGAAGTAGGACGG + Intronic
1021476678 7:21069603-21069625 CAGTCTAGATAGTAGGATGAAGG + Intergenic
1025622983 7:63191207-63191229 AAGTCTAATTATAAGAAAGAAGG - Intergenic
1025794979 7:64730970-64730992 CAGACTAACTAGAATAAACATGG - Intergenic
1025807722 7:64850890-64850912 CAGACTGACTAGAAGAAACATGG - Intergenic
1027745744 7:82071711-82071733 GACTCTTACTAGAAGGAAGGAGG - Intronic
1030337635 7:108343223-108343245 CAGTAGAATTAGAAGGAAAAAGG + Intronic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1036455782 8:8905857-8905879 CAGTCCACCGAGAAAGAAGATGG + Intergenic
1037619086 8:20547217-20547239 CATTCCAAATAGAAGCAAGAGGG + Intergenic
1041093085 8:54321985-54322007 CAGGCTAACTAAAAAGAAGGAGG + Intergenic
1042082247 8:65067519-65067541 CAGACTAAGTAAAAAGAAGATGG - Intergenic
1042717285 8:71788132-71788154 CAGTCCAACAAGGAGGAAAAAGG - Intergenic
1042736585 8:71996228-71996250 CAGCTTGACTAGAAGGAAGATGG - Intronic
1043572816 8:81624452-81624474 CAGTGAAACTAAAAGCAAGAAGG + Intergenic
1043731083 8:83682975-83682997 CAATTTGACTAGCAGGAAGATGG - Intergenic
1044920305 8:97162999-97163021 CTTTCTAGCAAGAAGGAAGATGG - Intergenic
1045133801 8:99189849-99189871 AAGTCTAAGTAGAATGAAAAAGG - Intronic
1046051843 8:109032891-109032913 CATTCTCACTTGAAGAAAGAGGG - Intergenic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1049252356 8:141596150-141596172 CTCTCTAAGTAGAAGGAAGCAGG + Intergenic
1050721581 9:8597541-8597563 CAGTGAAAATAAAAGGAAGAAGG + Intronic
1051103432 9:13549354-13549376 CAGATTAACTTGAAGGTAGAAGG + Intergenic
1056007756 9:82290880-82290902 CAATCTGAATAGAAGGAACATGG - Intergenic
1056617029 9:88177601-88177623 TAGTCTCAATAGAGGGAAGAAGG + Intergenic
1058868215 9:109180683-109180705 CAGTCTTACGAGATGGATGATGG - Intronic
1059205213 9:112458081-112458103 CAGTGGCACTAGAAGGTAGATGG - Intronic
1059609770 9:115879675-115879697 GAGTCTAACCAGAAGCCAGAAGG + Intergenic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1192399136 X:70816822-70816844 GAGTCAGAGTAGAAGGAAGAGGG + Intronic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1197347832 X:125345821-125345843 CAGCATAACTAAAAGGGAGATGG - Intergenic
1200412323 Y:2872994-2873016 CAGTCTTACTAGAAAGAGGTTGG + Intronic