ID: 952172480

View in Genome Browser
Species Human (GRCh38)
Location 3:30823304-30823326
Sequence GTGAGAAGTGATAATACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952172480_952172481 2 Left 952172480 3:30823304-30823326 CCTGGAGTATTATCACTTCTCAC 0: 1
1: 0
2: 1
3: 4
4: 139
Right 952172481 3:30823329-30823351 GCAGATATCCTAAAGACTTCAGG 0: 1
1: 0
2: 1
3: 2
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952172480 Original CRISPR GTGAGAAGTGATAATACTCC AGG (reversed) Intronic
903630178 1:24762736-24762758 GTGGGAAGTCATAATACAGCGGG + Intronic
903981666 1:27193071-27193093 GAGAGAATTGACAATTCTCCTGG - Intergenic
905302528 1:36995542-36995564 GTGAGAAGTGATGTGATTCCTGG - Intronic
908909568 1:69057256-69057278 GTGAGAAATGGTAAGACTCTGGG + Intergenic
909692001 1:78419881-78419903 CTGAAATGTGATAATACTGCTGG + Intronic
917972282 1:180216575-180216597 CTAAGAAGTCATAATACGCCAGG + Intergenic
922697574 1:227739025-227739047 ATGAGAGCTGATAACACTCCAGG - Intronic
924013054 1:239687339-239687361 TTTATAAGTGATAATATTCCAGG + Intronic
1063291859 10:4757865-4757887 CTGAGAAGGGATAACCCTCCTGG + Intergenic
1066143757 10:32535097-32535119 CAGAGAAGTGAAAAAACTCCGGG - Intronic
1068695270 10:59961681-59961703 GTGAGAAGTGCTTGTACTCAGGG + Intergenic
1074905503 10:117859765-117859787 GTGAGGGGAGATAATAATCCAGG - Intergenic
1075868729 10:125751658-125751680 GTGAGAAGTGACAATGGTCTTGG - Intronic
1076070957 10:127488636-127488658 GTGAGAAGTGAAAAAACTACTGG - Intergenic
1080147075 11:28999098-28999120 GTGAGAAGTGAAGATACCCTTGG - Intergenic
1086749508 11:90473543-90473565 ATGAGAAGTGACAACATTCCAGG - Intergenic
1090194820 11:124805825-124805847 GTGAGAACTGAAATTATTCCTGG - Intergenic
1090503526 11:127285200-127285222 GGGAGAAGTACTAATTCTCCTGG + Intergenic
1093142617 12:15527200-15527222 TAGAGAAGTGAAAATACTCTGGG + Intronic
1095237714 12:39818131-39818153 GTGAGAAGGGATCACACACCTGG - Intronic
1095874864 12:47068992-47069014 GTGAGAAGAGCTCAGACTCCAGG + Intergenic
1097184475 12:57189234-57189256 GTGAGAAGTGGTTTTCCTCCTGG - Intronic
1098080760 12:66782924-66782946 GTGAGAAATGATCAGAATCCTGG - Intronic
1099008752 12:77265729-77265751 GTCAGATGTGGTAATAGTCCTGG - Intergenic
1100017688 12:90031358-90031380 GAGACAAGTGATAATAATCAGGG - Intergenic
1100612811 12:96205715-96205737 GTTAGAACTGATTAAACTCCGGG + Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1106869655 13:34004991-34005013 GTGATGAGTCAGAATACTCCTGG - Intergenic
1107928082 13:45282799-45282821 GTAAGAAGTGATAATAAGGCCGG - Intronic
1113981375 13:114279936-114279958 GGGAGAAGTGGAAATACTCAAGG + Intergenic
1114807193 14:25851746-25851768 TAGAGAAGTGTTAATACACCGGG - Intergenic
1117064297 14:51994569-51994591 GGGAGATATTATAATACTCCTGG - Intronic
1126712276 15:51472293-51472315 GTGAAAAGTGATCATATTCTGGG - Intronic
1127146403 15:56028825-56028847 GTGTGAAATGTAAATACTCCTGG - Intergenic
1128188634 15:65668003-65668025 GCCAGAAGTACTAATACTCCTGG + Exonic
1129302537 15:74633828-74633850 CTGAGAAATGCTAATACTCTAGG - Intronic
1130969396 15:88720375-88720397 ATGAGAACTGATGATACTCAGGG - Intergenic
1132276102 15:100565445-100565467 ATGAGAAGTGATCCTTCTCCAGG - Intronic
1133617721 16:7494127-7494149 GTGAGAAGAGATAATTCACATGG + Intronic
1138978881 16:62242229-62242251 GTGGGAAGTGATTATACTATAGG + Intergenic
1140665703 16:77225223-77225245 GTTGTAAGTGATAACACTCCTGG - Intergenic
1141375203 16:83523971-83523993 TTGAGAGGTGCAAATACTCCTGG - Intronic
1144961043 17:19044281-19044303 TTGAGCAGTGATACTCCTCCAGG - Intronic
1144974118 17:19130243-19130265 TTGAGCAGTGATACTCCTCCAGG + Intronic
1150997414 17:70334650-70334672 GTGAGAAGTGATAATAAATGGGG - Intergenic
1153191725 18:2548306-2548328 GGGAGAAGTCATTATTCTCCTGG + Intronic
1156011870 18:32505749-32505771 GTGATAAGGGAAAATCCTCCTGG - Intergenic
1157080789 18:44522861-44522883 ATGATAAATGATAATTCTCCAGG + Intergenic
925300151 2:2805896-2805918 GAGAGAGGTGACAATACCCCTGG - Intergenic
935586260 2:104802509-104802531 GTGAGAAGAGTCAATACTGCAGG - Intergenic
940822720 2:158375153-158375175 GTGACAAGTGATCAGACTCTGGG - Intronic
942337108 2:174900446-174900468 GTGAGCTATGATCATACTCCAGG + Intronic
943235389 2:185311767-185311789 GTGAGAAGTGGTAATTCTCCAGG + Intergenic
944483963 2:200184066-200184088 ATGAGATGTGATAATACACATGG + Intergenic
945988038 2:216370882-216370904 GGGAGAAGTTTTAATTCTCCTGG + Exonic
1168758494 20:332420-332442 GTGAGAAGTGACAAGACACAGGG - Intergenic
1170394528 20:15911658-15911680 GGGAGAAGTGAGAAAACACCAGG + Intronic
1171480365 20:25450863-25450885 ATGAGAAGTGATATCACTACAGG - Intronic
1172373070 20:34410980-34411002 ATGGGAAGTGATAAAATTCCAGG - Intronic
1174065508 20:47861918-47861940 GTGAGAAGTGATTGTACACACGG + Intergenic
1174274594 20:49394581-49394603 CTGAGAAGTGCTAAGACTTCTGG - Intronic
1177334931 21:19711283-19711305 GTGATAAGTGATAAAATTCTGGG - Intergenic
1177786684 21:25679266-25679288 AAGAGAATTGATTATACTCCTGG - Intronic
1178079007 21:29043522-29043544 GAGAGAAGTGATATTCCTTCTGG + Exonic
1181735429 22:24877766-24877788 TTGAGAAGTGCTAATATTACTGG + Intronic
1182530336 22:30950772-30950794 GGCAGAAGTGATAGTAATCCAGG - Intronic
949621349 3:5815366-5815388 TTGAGAAGTCATGATACTACAGG + Intergenic
949733279 3:7140238-7140260 GTGAGAAGTTATAAGACTAAAGG + Intronic
949876115 3:8627121-8627143 GTGAGGAGTAAAAATACTCAAGG - Intronic
952172480 3:30823304-30823326 GTGAGAAGTGATAATACTCCAGG - Intronic
952221652 3:31329271-31329293 GTGAGACTTGATAAAACTTCAGG + Intergenic
952563224 3:34620666-34620688 CGGAGAAGTGAGAAAACTCCAGG - Intergenic
954656862 3:52199090-52199112 GGGAGAAGTGTTAGTATTCCAGG + Intronic
956566917 3:70649354-70649376 TTGAGAAGTGACTATACTACTGG - Intergenic
956922396 3:73943845-73943867 GTGAGAGATGAATATACTCCAGG - Intergenic
958194367 3:90223907-90223929 GTGAGAAATGAACAAACTCCTGG + Intergenic
958417733 3:93894958-93894980 GTGAGAAATGAACAAACTCCTGG + Intronic
959327935 3:104961513-104961535 GTGAGAAGTTATTATCCTTCAGG - Intergenic
959869899 3:111314287-111314309 TTGAAAAGTGTTAAAACTCCAGG + Intronic
962461759 3:135620749-135620771 GTGAGAAGTATCAATAGTCCAGG + Intergenic
964464438 3:156974938-156974960 GTGAGAAGTGATGAGATTCAGGG + Intronic
966277251 3:178188644-178188666 GGGAGCAGTGATAATATTCAGGG + Intergenic
966496177 3:180583949-180583971 GTGAGAAGGTATAACACCCCTGG + Intergenic
967047731 3:185753230-185753252 GTTAGAGGTGATATAACTCCTGG + Intronic
967642418 3:191881748-191881770 GTGAAAAATGATGATACTCTTGG + Intergenic
968279553 3:197465860-197465882 CTGAGAAAGGAAAATACTCCAGG - Intergenic
969067089 4:4494525-4494547 GGGAGAAGTGATAATATTAGAGG - Intronic
970115977 4:12695979-12696001 GTGAGAACTGAACATCCTCCTGG + Intergenic
970320954 4:14874930-14874952 GTGAGAAATGCTATAACTCCTGG + Intergenic
974794005 4:66725594-66725616 GTGAGAAGTGAATATTCTCAGGG - Intergenic
975675925 4:76827541-76827563 GTGATAAGGGGTAATACCCCGGG + Intergenic
979212775 4:118125805-118125827 GTGATAAATGATAATATTTCTGG - Intronic
980579143 4:134726929-134726951 GTGAGAAATGATAATAAAACTGG - Intergenic
994206543 5:97042574-97042596 GTGGGAAGGGGTAAGACTCCAGG - Intergenic
999639106 5:153653570-153653592 GTTAGAAGTGAGAATAGACCAGG + Intronic
1000246265 5:159450914-159450936 GTGAGAAGTGACAAGATTCAAGG + Intergenic
1000275939 5:159734726-159734748 GAAAGAATTGAAAATACTCCTGG + Intergenic
1002518380 5:179775689-179775711 GTGGGGAGACATAATACTCCAGG - Exonic
1004919343 6:20361500-20361522 GAGAAAGGGGATAATACTCCTGG + Intergenic
1005668609 6:28081882-28081904 ATGAGAAGTGATAAAACACCTGG + Intronic
1005852868 6:29835245-29835267 GTGAGGAGTGAAAATGCCCCAGG + Intergenic
1006441256 6:34054951-34054973 GTGAGAAGTGAAAAGATGCCTGG - Intronic
1006619265 6:35351375-35351397 GTTAGAAGTTATAATAGGCCGGG + Intronic
1010072342 6:71758824-71758846 GAGATAATTGAAAATACTCCAGG + Intergenic
1012476351 6:99618677-99618699 GGGAGTAGTGATAACACTGCTGG + Intergenic
1013219513 6:108065531-108065553 TTAAGAAGTGATAATAGGCCAGG - Intronic
1014540379 6:122668728-122668750 GTGAGATGTGCTAATATTCCTGG - Intronic
1022069803 7:26901685-26901707 GGCAGAAGATATAATACTCCTGG - Intronic
1022304283 7:29131877-29131899 TTTGCAAGTGATAATACTCCAGG + Intronic
1022635961 7:32135286-32135308 GTGAGAAGTGAGAGTTCTCAAGG + Intronic
1022670690 7:32452610-32452632 GGCAGAAGTCATATTACTCCAGG + Intergenic
1023630528 7:42159388-42159410 GTGGGAAGGGATTATACTCTTGG - Intronic
1023637400 7:42226469-42226491 GTGAGAAGAGGTAAAGCTCCAGG + Intronic
1026583585 7:71637789-71637811 GTGAGCAGTGCTAATATTGCTGG + Intronic
1027662636 7:81005661-81005683 GTTAGTAGTGATGATTCTCCTGG + Intergenic
1030574392 7:111267741-111267763 ATGAGAAGTAATATTACCCCTGG - Intronic
1031207107 7:118774158-118774180 ATGGAAAGTGATTATACTCCTGG + Intergenic
1031388356 7:121181136-121181158 GTGAGAGATGATCATACTGCAGG + Intronic
1031584360 7:123516938-123516960 GTCAGAATAGATAAGACTCCTGG + Intronic
1032455775 7:132072514-132072536 GGGAGAAGTGCTAAGACTTCAGG + Intergenic
1036436335 8:8737375-8737397 GTGAGAAGTGATGAATTTCCAGG - Intergenic
1036494938 8:9261805-9261827 GGGAGAAGTGTAAATACTACAGG - Intergenic
1036718972 8:11154603-11154625 GTGAGAAGTGAGAGTAGTCTTGG + Intronic
1039623290 8:39021675-39021697 GAGAGAAGAGATGATTCTCCTGG + Exonic
1040314504 8:46253890-46253912 GGGAGAAGAGATAAGACTGCAGG + Intergenic
1040329102 8:46376885-46376907 GTGAGAAGTGGTGAGACTGCAGG + Intergenic
1042790788 8:72603410-72603432 GGGAGAAGGGATAATATTCAAGG - Intronic
1043803985 8:84647667-84647689 AAGAGAACTGATAAAACTCCTGG + Intronic
1047748064 8:127860058-127860080 ATGAGAACTGATGACACTCCAGG + Intergenic
1050128082 9:2380225-2380247 GTCAGAGATGATATTACTCCAGG - Intergenic
1050806366 9:9683432-9683454 GTGAGGAGATATAATAATCCAGG + Intronic
1051747015 9:20304733-20304755 TAGAGAAGTGAAAATAGTCCAGG - Intergenic
1054949686 9:70836083-70836105 GTGATAAATGATAAACCTCCAGG + Intronic
1055296259 9:74836778-74836800 GAAAGAAGTGATAAAGCTCCTGG - Intronic
1058326132 9:103700277-103700299 GTGAGAAGCTATTATACTCAGGG - Intergenic
1186149708 X:6661226-6661248 GTTAGAAGTGTGAATTCTCCAGG - Intergenic
1189588888 X:42490917-42490939 GTGAGAAGTGATAATATTGGTGG + Intergenic
1190233429 X:48599251-48599273 GTGAGAAGTGATCTGACTCTAGG + Intronic
1196386022 X:115152110-115152132 GTGGGAACTGGTACTACTCCTGG - Intronic
1198525726 X:137498633-137498655 GTGAGAAATGGAAATAATCCAGG + Intergenic
1199456045 X:148030238-148030260 GGGAGAACTGATACTACTACGGG + Intergenic
1200766952 Y:7088220-7088242 GAGAGAAGTGATGATGCTCTAGG + Intronic
1202252629 Y:22889009-22889031 GTGAGATGTGACAATCCACCTGG + Intergenic
1202405618 Y:24522758-24522780 GTGAGATGTGACAATCCACCTGG + Intergenic
1202465162 Y:25147324-25147346 GTGAGATGTGACAATCCACCTGG - Intergenic