ID: 952177977

View in Genome Browser
Species Human (GRCh38)
Location 3:30887491-30887513
Sequence CAGTATCCCAAGGTGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 1, 2: 15, 3: 80, 4: 337}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952177977_952177981 2 Left 952177977 3:30887491-30887513 CCCTGCACCACCTTGGGATACTG 0: 1
1: 1
2: 15
3: 80
4: 337
Right 952177981 3:30887516-30887538 AAGAATCCCCACAAGCAAGAAGG 0: 2
1: 1
2: 23
3: 238
4: 901

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952177977 Original CRISPR CAGTATCCCAAGGTGGTGCA GGG (reversed) Intronic
900320585 1:2081573-2081595 CATCATGCCAAGGTGGTGCTGGG + Intronic
900403778 1:2483695-2483717 CAGAAACCCAAGGTGCTACAGGG - Intronic
901673419 1:10868898-10868920 CTGTGTCCCAGGGGGGTGCATGG + Intergenic
903028249 1:20444618-20444640 CAGGAGCCCAAGGTGGTGGTGGG + Intergenic
903797595 1:25941527-25941549 CAGAGTCCCAAGGTGGTGCAGGG + Intergenic
904484557 1:30816230-30816252 CAGCATCCCGAGGAGGTGCCCGG - Intergenic
905615950 1:39398889-39398911 CAGTACTCCCAGCTGGTGCAAGG - Intronic
907320531 1:53599405-53599427 CAGAGTCCCGAGGTGGCGCAGGG - Intronic
908303929 1:62791561-62791583 CAGAGTCCTGAGGTGGTGCAGGG + Intronic
909369720 1:74870003-74870025 CAGTGTCCTGAGGTTGTGCAGGG - Intergenic
909455697 1:75846094-75846116 CAGAGTTCCAAGGTGCTGCAGGG + Intronic
909741652 1:79037033-79037055 CAGTGTCCCAAGGTTGTGCAGGG - Intergenic
910110060 1:83673355-83673377 CAGAATCCTCATGTGGTGCAAGG + Intergenic
910273265 1:85420108-85420130 CAGTGTCCCGAGGCTGTGCAGGG + Intronic
910831925 1:91469967-91469989 CAGAGTCCCAAGGCAGTGCAGGG - Intergenic
915027418 1:152843801-152843823 TAGTACCCAAAGGTGGGGCAGGG - Exonic
917188559 1:172388798-172388820 CAGTGTCCCAAGGTAAGGCATGG + Exonic
917519943 1:175739879-175739901 CAGTATTCCAAGTTGGTGGTTGG - Intronic
917696830 1:177533956-177533978 CAGTGTCCCAAGGTTGCACAGGG + Intergenic
918485882 1:185027660-185027682 CAGTGTTCCAAGGTTGTGCAGGG + Intergenic
918659422 1:187071660-187071682 CAGCCTCCCAAGGTGCTGCTGGG + Intergenic
920891042 1:209985920-209985942 CAATTTCCCAAGGCTGTGCAGGG + Intronic
922069240 1:222174687-222174709 CAGTGTCCCAAGGCTGTGCAGGG + Intergenic
922229659 1:223674541-223674563 CACTGTCCCGAGGTTGTGCAGGG + Intergenic
922589360 1:226762649-226762671 GAATATCCCTAGGTGGGGCAGGG + Intergenic
923281625 1:232448691-232448713 CAGAATGCCAAAATGGTGCAGGG + Intronic
923774963 1:236969852-236969874 CAGCATCCCTAGGTGGTGCAGGG + Intergenic
1062881355 10:980652-980674 CAGTGTCCCAAGGCTGTGCAGGG + Intergenic
1062904363 10:1169867-1169889 CAGCCTCCCAAGGTTGTGCTGGG - Intergenic
1063492876 10:6481180-6481202 CGGTATCCCAAGGTGCAGCTGGG - Intronic
1064243485 10:13651148-13651170 CAGTAGGCCAGGGTGGTGCCCGG + Intronic
1064547987 10:16469829-16469851 CAGCCTCCCAAAGTGGTGCTGGG + Intronic
1066695893 10:38077181-38077203 CAGTGTCCTGAGGTTGTGCAGGG + Intergenic
1067032849 10:42890507-42890529 CAGAGTCCCAAGGTGGCTCAAGG - Intergenic
1068369113 10:56091015-56091037 CAGTGTGCCAAGGCTGTGCAGGG - Intergenic
1069600707 10:69705029-69705051 CAGCATCCCAAGGCTGAGCAAGG - Intergenic
1069957847 10:72062639-72062661 CAGTCCCCCCAGGTGGAGCAGGG + Exonic
1070202720 10:74223188-74223210 CAGATTCCTGAGGTGGTGCAGGG + Intronic
1070266492 10:74908164-74908186 CAGAATCTCATGGTAGTGCAGGG - Intronic
1073231817 10:101977808-101977830 TAGAGTCCCAAGGTGGTGCAAGG - Intronic
1073612759 10:104960481-104960503 CAGAGTCCCAAGGTGGCACAGGG + Intronic
1073701710 10:105934904-105934926 CAGTGTCCCAAGGCTGTGCAGGG - Intergenic
1073893742 10:108129937-108129959 GAGAATCCCCAGGTTGTGCATGG - Intergenic
1074657942 10:115616628-115616650 CAGTGTCCCAAGGTTGCACAAGG - Intronic
1074887507 10:117705582-117705604 CAGAGTCCCAAGGTGGCACAGGG - Intergenic
1075579002 10:123602740-123602762 CAGGATGCTAAGGTGGGGCAAGG + Intergenic
1075658688 10:124178381-124178403 CAGAATCCCCAGGTGGTGCAGGG + Intergenic
1076852825 10:133101422-133101444 CAGCGTCCCACGGTGCTGCACGG - Intronic
1077399865 11:2349577-2349599 CAGTGTCCCAAGGCTGTGCAGGG - Intergenic
1077845159 11:6015302-6015324 CAGTGTCCCCAGGCTGTGCAGGG - Intergenic
1077978821 11:7278078-7278100 AAGAGTCCCAAGGTGGTGTAAGG + Intronic
1080182637 11:29443108-29443130 CAGTTTCTCAAGGCTGTGCAGGG + Intergenic
1080533394 11:33198464-33198486 CATTATCCCAAACTGGGGCAAGG - Intergenic
1083362252 11:62118608-62118630 CAGAGTCCCAAGGTGGCACAGGG + Intergenic
1083495425 11:63047852-63047874 CAGTAGCCCACTGTGGTGCCTGG + Intergenic
1085325415 11:75602562-75602584 CAGTGTGGCAAGGTGGTGCTCGG + Intronic
1085896383 11:80644540-80644562 CAGCATCCTGAGGTGGCGCAGGG - Intergenic
1085976381 11:81660336-81660358 CAGTTTCCCAAGGTTGTGCAGGG + Intergenic
1086576162 11:88341128-88341150 CAGAATCCCAAGGTAGTACAGGG + Intergenic
1086734049 11:90283726-90283748 CAGTCTCCCACTGTGGTGCCTGG + Intergenic
1086954826 11:92925290-92925312 CAGTGTCCCAAGGTTGCACAGGG - Intergenic
1087222422 11:95560632-95560654 CAGAGTCCCACAGTGGTGCAGGG - Intergenic
1087618722 11:100518398-100518420 CAGCATCCCAAGGTGGCTCAGGG + Intergenic
1089821115 11:121226990-121227012 CAGTCTCCTGGGGTGGTGCAGGG + Intergenic
1092471659 12:8786932-8786954 CAGTGTCCCAAGGCTGTGCAGGG + Intergenic
1094649271 12:32359407-32359429 CAGAGTCCCAAAGTGGTGCAGGG + Intronic
1095782735 12:46078189-46078211 CAGTGTCCCAAGGTTGCACAGGG + Intergenic
1095804512 12:46303806-46303828 CAGTAGCCCTCGGTGGAGCAGGG + Intergenic
1096050898 12:48606502-48606524 CAGTATCCCAAGGTTGCACAGGG + Intergenic
1096959875 12:55567623-55567645 CAGTGTCCCAAGGATATGCAGGG - Intergenic
1097136844 12:56864278-56864300 CACTGTTCCAAGGTTGTGCAGGG - Intergenic
1098325553 12:69298364-69298386 CAGTGTCCTAAGGCTGTGCAGGG - Intergenic
1098434058 12:70450458-70450480 CAATGTCCCATGGTTGTGCAGGG - Intergenic
1098559126 12:71852258-71852280 CAGTGTCCTGAGGTTGTGCAGGG + Intronic
1099487737 12:83249246-83249268 CAGTGTCCCAAGGTTGCACAGGG - Intergenic
1099996898 12:89787875-89787897 TAGAGTCCCAAAGTGGTGCAGGG + Intergenic
1100933244 12:99634341-99634363 TAGAGACCCAAGGTGGTGCAGGG - Intronic
1105381930 13:19895504-19895526 AAGTGTCTCAAGGTGATGCAGGG + Intergenic
1105793964 13:23832258-23832280 CAGAGTCCCAAGGTGGCTCAGGG - Intronic
1106161811 13:27207938-27207960 CAGAGTTCCAAGGTGGTGCACGG - Intergenic
1106194358 13:27480645-27480667 CAGAATCCCCAGGCAGTGCAGGG - Intergenic
1107607465 13:42074551-42074573 CTGTATGCCAAGGTAGGGCAAGG - Intronic
1108230259 13:48331534-48331556 CAGAGTCCTGAGGTGGTGCAGGG - Intronic
1111102485 13:83606190-83606212 CAGCATCCCAAGGTGGCAAAGGG - Intergenic
1111222919 13:85228264-85228286 CAAGACCCCAAGCTGGTGCAAGG + Intergenic
1111494807 13:89034184-89034206 CAGTGTCCCAAAGCTGTGCAGGG - Intergenic
1112039741 13:95535117-95535139 GAGTATTCCAAGGTGCAGCATGG + Intronic
1113259566 13:108546733-108546755 CAGAACCCCAAAGTGGGGCATGG + Intergenic
1114255692 14:20999641-20999663 CAATATCCCAAGGTTGGGGATGG - Intronic
1115312330 14:31992071-31992093 TAGGCTCCCAAGGTGATGCATGG - Intergenic
1116798133 14:49413590-49413612 CAGTATCCTGAGGAGGTGAAAGG - Intergenic
1117964952 14:61197480-61197502 CAGAGTCCCAAGGCAGTGCAGGG + Intronic
1118595796 14:67434881-67434903 CAGAGTCCTGAGGTGGTGCAGGG + Intergenic
1119413639 14:74455289-74455311 CAGGACTCCAGGGTGGTGCAGGG - Intergenic
1121372848 14:93375980-93376002 CAGAGTCCCAAGGTGGCACAGGG - Intronic
1121384799 14:93510161-93510183 CAGTGTCCTGAGGTTGTGCAGGG + Intronic
1121430432 14:93882575-93882597 CAGAGTCCCAAGATGGTGCAGGG + Intergenic
1122831867 14:104402107-104402129 CAGTGTCCCAAAGTTGTACAGGG - Intergenic
1122846620 14:104503787-104503809 CAGTAGCTGAGGGTGGTGCAGGG - Intronic
1122866556 14:104607640-104607662 CAGAGTCCCAAGGTGGTGCAGGG - Intergenic
1124438333 15:29669406-29669428 TAGAGTCCCAAGGTGGTGCCGGG - Intergenic
1124686357 15:31786105-31786127 CAGAGTCCCCAGGTGGCGCACGG - Intronic
1124716949 15:32072655-32072677 CAGTGTCCTAAGGCTGTGCAGGG - Intronic
1127137848 15:55943421-55943443 CAGTGTCCCAAGGTTGTGTAGGG - Intronic
1127181557 15:56424645-56424667 CAGTAACACAAGGTAGGGCAGGG - Intronic
1129757291 15:78106059-78106081 CAGTATCCCAAGAGTGTGCATGG - Intronic
1129812814 15:78524399-78524421 CAATATCCCAAGGCTGTGTAGGG + Intronic
1130690024 15:86074232-86074254 CTGTATCCTCAGGTGGTGAAAGG + Intergenic
1130828654 15:87576954-87576976 CAGAGTTCCAAGGTGTTGCAGGG - Intergenic
1131198885 15:90379675-90379697 CAGTGTCCCAAGGCTGTGCAGGG + Intergenic
1132808864 16:1788210-1788232 GAGTGTCCCAAGCTGGTGCTGGG + Intronic
1134067687 16:11239735-11239757 CAGAGTCCCAAGGTGGCACAGGG + Intergenic
1136254511 16:29029308-29029330 CCTGATCCCAAGGTGTTGCAGGG - Intergenic
1137285457 16:47012587-47012609 CAGAGTCCCAAGGTGGCGCAGGG + Intergenic
1137396271 16:48117889-48117911 CAGTATCCCGAGTTGTTGCAGGG - Intronic
1137403172 16:48170006-48170028 CAGTGTCCCACGGTAGTGAAGGG + Intronic
1137785444 16:51134357-51134379 GCGCAGCCCAAGGTGGTGCAGGG + Intergenic
1138301118 16:55930533-55930555 CAGAGTCCCAAGGTGGCACAAGG - Intronic
1138323654 16:56142056-56142078 AAGCGTCCAAAGGTGGTGCAGGG + Intergenic
1138493305 16:57390859-57390881 CAGAGTCCCAAGGTGGGGCAGGG - Intergenic
1138970193 16:62134157-62134179 CAGTACCCTGAGGTGGTGCAGGG + Intergenic
1139336244 16:66233592-66233614 CAGCATGCAAAGCTGGTGCAAGG - Intergenic
1139381403 16:66534172-66534194 CAGAGTCCCCAGGTGGTACAGGG - Intronic
1141096393 16:81166004-81166026 CAGTAACCAAAGATGGTGTATGG - Intergenic
1141808554 16:86358230-86358252 CAGGCTCCCAAGCTGGCGCAAGG - Intergenic
1141926596 16:87174114-87174136 AAGGATCCCAAGGGGGTGCCAGG - Intronic
1143929719 17:10409455-10409477 CAGAAGCCCAAGGTGGTCAAAGG - Exonic
1143940630 17:10537409-10537431 CAGAAGCCCAAGGTGGTCAAAGG - Exonic
1143952243 17:10642590-10642612 CAGAAGCCCAAGGTGGTCAAAGG - Exonic
1144347819 17:14365886-14365908 CAGAGTTCCAAGGAGGTGCAGGG + Intergenic
1144394864 17:14834221-14834243 TTGTATCCCAAGGTGGTGACGGG - Intergenic
1144943752 17:18959387-18959409 CAGAATACCAAGGTGCTGGATGG + Intronic
1145751138 17:27355894-27355916 CAGTGTCCAAAGCAGGTGCAAGG - Intergenic
1146734790 17:35229309-35229331 CAGTCTCCCAAAGTGCTGCTGGG + Intergenic
1147037857 17:37695159-37695181 CAGTGTCCCAAGGCTGTGCAGGG - Intronic
1147541475 17:41363837-41363859 TAGTACCCAAAGGTGTTGCAAGG + Exonic
1149799957 17:59558013-59558035 CAGCCTCCCAAAGTGGTGCTGGG + Intergenic
1149853208 17:60054122-60054144 CAGTGCCCCAAGGCTGTGCAGGG - Intronic
1150858814 17:68779317-68779339 CAGTATCCCAAAGGGGTTAAGGG - Intergenic
1151249774 17:72825180-72825202 CAGTGTCCCAATGTTGTGCAGGG - Intronic
1152160409 17:78665027-78665049 CAGTTTCCCATGGTGTTGCCTGG - Intergenic
1152919974 17:83061734-83061756 CAGGAGCCCACGGAGGTGCAAGG - Intergenic
1153640989 18:7156778-7156800 CAGAGTCCCAAGGTGGGACAGGG - Intergenic
1153916848 18:9753416-9753438 TAGAGTCCCAAGGTGGAGCAGGG - Intronic
1154510380 18:15094072-15094094 AATTTTCCCAAGGTGGTGAAGGG - Intergenic
1155607712 18:27626295-27626317 CAGAGTCCCAAGGTGGTCCAGGG - Intergenic
1155792997 18:29997635-29997657 CAGTGTCCCAAGGTTGCACAGGG - Intergenic
1156195249 18:34767616-34767638 CAGAGTCTCAAGATGGTGCAGGG + Intronic
1157630038 18:49086272-49086294 CAGAGTCCCAAGGCAGTGCAGGG + Intronic
1157973410 18:52297759-52297781 AAGTAGCCTATGGTGGTGCATGG + Intergenic
1158092220 18:53727632-53727654 CAGTGTCTCAAGGTTGCGCAGGG + Intergenic
1160010802 18:75105947-75105969 CAGAATCCGAAGGAGGTTCAGGG + Intergenic
1162877111 19:13628525-13628547 CAGAGTCCCAAGTCGGTGCAGGG - Intergenic
1164100832 19:22052903-22052925 GAGTCTCCCCAGGTTGTGCAGGG + Intronic
1164549927 19:29201412-29201434 CAGAGTCCCAAGGTGGTACAGGG - Intergenic
1165969405 19:39613833-39613855 CAGTGTCCCAAGATTGTGCAGGG - Intergenic
926499878 2:13641140-13641162 CAGCAGGCCAAGGTGGGGCAAGG - Intergenic
926798496 2:16638456-16638478 CAGCATCCCTTAGTGGTGCATGG - Intronic
928790147 2:34940362-34940384 CAGAGTCCTGAGGTGGTGCAGGG + Intergenic
929574440 2:43043092-43043114 TGGGATCCCAAGGTGGTCCAAGG - Intergenic
930200415 2:48547515-48547537 CAGTGTCCCATGGTCGTGCGGGG + Intronic
930828558 2:55718761-55718783 CAGTTTCAGAATGTGGTGCAAGG + Intergenic
930940899 2:57013425-57013447 CAGTGTCCCCAGGTTGTGCAGGG - Intergenic
931800951 2:65757072-65757094 CAGTGTCCCAAGGCTATGCAAGG + Intergenic
932364508 2:71140332-71140354 CAGAGTCCCAAGGTGGTGCAGGG + Intronic
932637735 2:73407139-73407161 CAGAATCCTGAGGTGGTGCAGGG + Intronic
933230264 2:79798914-79798936 CAGTGTTCCAAGGTGATGCATGG + Intronic
933985794 2:87591267-87591289 CAGTGTCCCAAAGCTGTGCAGGG - Intergenic
935589463 2:104832631-104832653 CAGTATCTCAAAGTGGTTTATGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936308048 2:111359537-111359559 CAGTGTCCCAAAGCTGTGCAGGG + Intergenic
936905718 2:117533815-117533837 CAATGTCCCAAGGCTGTGCAAGG - Intergenic
936926045 2:117737823-117737845 CAGAATCCCTTGGTGGTGAATGG + Intergenic
937327871 2:121002846-121002868 CAGTGTCCCAAGGCTGTGCAAGG - Intergenic
938816371 2:134908701-134908723 CAGAATCCCAAGATAGTACAGGG + Intergenic
938974174 2:136459471-136459493 CAGTATCACAAGGCTGTGCAGGG + Intergenic
939023486 2:136985360-136985382 CAGTATCCCAAGGCTGTACAAGG - Intronic
939046545 2:137256982-137257004 CAGAGTCCCAAGGTGGCACAGGG + Intronic
940121566 2:150273673-150273695 CAGAGTCCCAAGTTGGTGCAGGG + Intergenic
940151032 2:150600824-150600846 AGGTGTCCCAGGGTGGTGCAGGG + Intergenic
940378569 2:152986963-152986985 CTGTGTCCAAAGGTGGTGGAGGG - Intergenic
940450089 2:153826182-153826204 CAGAGTTCCAAGGTGGTGCAGGG + Intergenic
940793741 2:158055189-158055211 CTGAGTCCCAAGGCGGTGCAGGG + Intronic
942343711 2:174978574-174978596 TAGTCTCTCAATGTGGTGCAGGG - Intronic
943212914 2:184990569-184990591 CAGAGTCCCAAAGTGATGCAGGG - Intergenic
943481668 2:188427499-188427521 CAGTGTCCCAAGTCTGTGCAGGG - Intronic
943663753 2:190587321-190587343 CTGTAACCCAAGCTGCTGCAAGG + Intergenic
945410266 2:209498782-209498804 CAGTATCCTAAGGCTGTGCCAGG + Intronic
946096279 2:217277224-217277246 CCGTATCCTCAGGTGGTGGAGGG + Intergenic
946791454 2:223304608-223304630 CAGAGTCCCAAGGTGGTACAGGG + Intergenic
946805016 2:223463237-223463259 CAGTGTCCCAAAGCTGTGCAGGG - Intergenic
947081125 2:226398362-226398384 CAGTATCACAACCTGCTGCACGG - Intergenic
948036293 2:234860953-234860975 CAGAGTCCCGAGGTGGTGCAGGG + Intergenic
948141792 2:235678738-235678760 CAGGATCCCAAGGTGGGGGCGGG - Intronic
948242827 2:236452593-236452615 CAGTTTCCCAAGGAGGGCCATGG - Intronic
948658648 2:239492601-239492623 CAGAAACCCAAGGCTGTGCAGGG + Intergenic
948756113 2:240160593-240160615 CAGGACCACAAGGTGGTACAGGG - Intergenic
948957268 2:241303271-241303293 CAGGAGCCCCAGATGGTGCAGGG + Intronic
1170051549 20:12151115-12151137 CAGAATCCCAAGGCAGTGCAGGG + Intergenic
1171490641 20:25514709-25514731 CAGTGTCCCAAGGTTGCACAGGG - Intronic
1172310855 20:33917428-33917450 CAGTGTCCCAAGGCAGTGTAGGG - Intergenic
1173314549 20:41931483-41931505 CAGTCTCCCAAGGTGACACAGGG + Intergenic
1173460253 20:43237543-43237565 CAGAGCCCCGAGGTGGTGCAAGG + Intergenic
1173584230 20:44169901-44169923 CAGAGTCCCAAGGTGGCACAGGG - Intronic
1173955613 20:47030318-47030340 CAGTACCCCTAGGGGGTGCCTGG - Intronic
1175198821 20:57264776-57264798 CAGCCTCCCAAAGTGGTGCTGGG - Intronic
1175410328 20:58763397-58763419 CAGCAGCTCAATGTGGTGCATGG + Intergenic
1176251200 20:64120971-64120993 CAGAGTCCCAAGGCAGTGCAGGG - Intergenic
1176787487 21:13275330-13275352 AATTTTCCCAAGGTGGTGAAGGG + Intergenic
1177187002 21:17808155-17808177 CAGTGTCTCAAGGTTGCGCAGGG - Intronic
1177676626 21:24309026-24309048 CAGCATCCCAAGGTGGTACAGGG + Intergenic
1177835765 21:26184741-26184763 CAGTGTTCCAAGGCTGTGCAGGG + Intergenic
1178838994 21:36123494-36123516 CAGAGTTCCAAGGTGGTACAGGG + Intergenic
1180112837 21:45672195-45672217 CAGAGTCCTGAGGTGGTGCAGGG - Intronic
1180249543 21:46572620-46572642 CAGACTCCCAAGGTAGTGCAGGG - Intergenic
1182144022 22:27985754-27985776 CAGTATTTAAAGCTGGTGCATGG + Intronic
1183669371 22:39263438-39263460 CAGGTTCCCAAGATGGCGCAGGG + Intergenic
1184393661 22:44219892-44219914 CAGAGTCCCGAGGTGGTGCAGGG + Intergenic
1184493563 22:44824435-44824457 CAGTGACACAAGATGGTGCAGGG - Intronic
1184619300 22:45662823-45662845 CAGAGTCCCAAGGCAGTGCAGGG + Intergenic
1185229084 22:49670283-49670305 CAGGAGCCCAGGGTGGCGCAGGG + Intergenic
949128132 3:470833-470855 CAGTGTCCCAAGGCTGCGCAGGG - Intergenic
949443302 3:4107084-4107106 CAATAGCCCAAGGTTGGGCATGG + Intronic
950555575 3:13693861-13693883 CAGAGTCCCAGAGTGGTGCAAGG + Intergenic
950684999 3:14610489-14610511 CAGAGTCCCAAGGTGGTGCAAGG - Intergenic
950776066 3:15351600-15351622 GAGTGTCCCAAGGCTGTGCAGGG - Intergenic
950972433 3:17202638-17202660 CAGTGTCCCAGGTTTGTGCAGGG - Intronic
950985282 3:17357216-17357238 CAGAAAGCCAAGGTGGTGGAGGG + Intronic
951241225 3:20288152-20288174 CAATGTCCCAAGGCTGTGCAGGG + Intergenic
951255806 3:20448005-20448027 CAGTTTCTCAATCTGGTGCAAGG + Intergenic
952177977 3:30887491-30887513 CAGTATCCCAAGGTGGTGCAGGG - Intronic
952225475 3:31371296-31371318 CAGTGTCCCAAGGCAGTGTAGGG + Intergenic
954131898 3:48565112-48565134 CACTATCCCAAGGAGCTTCAGGG + Exonic
954467766 3:50666577-50666599 CAGTCTTCCATGGGGGTGCAGGG + Intergenic
956042748 3:65162790-65162812 CAGTTTCCAAGGGTGGAGCAAGG + Intergenic
956489168 3:69753121-69753143 CAGTGTCCCAAGGCTATGCAGGG - Intronic
956727264 3:72166468-72166490 CAGCCTCCCAAGGTGGTGTTGGG - Intergenic
956929333 3:74024930-74024952 CAGAGTCCCAATGTGGTACAGGG - Intergenic
958557974 3:95704605-95704627 CAGTGTTCCAAGGCTGTGCAGGG - Intergenic
959133880 3:102392439-102392461 TAGAGTTCCAAGGTGGTGCAGGG + Intronic
959245495 3:103862717-103862739 CAGCCTCTCAAGATGGTGCAGGG - Intergenic
959893198 3:111579617-111579639 AAGAATCCCAAGGTGGCACACGG + Intronic
960214128 3:115009790-115009812 CTGTATCCCAACGTGGTAGAAGG - Intronic
960712628 3:120546157-120546179 CAGAGCCCCAAGATGGTGCAGGG + Intergenic
960766295 3:121134187-121134209 TGGTGTCCCGAGGTGGTGCAGGG + Intronic
960952367 3:123007680-123007702 CAGAATCCCAAGGTGGTGCAGGG - Intronic
961465167 3:127076978-127077000 CAGAATCACATGGTGGGGCAAGG + Intergenic
962005335 3:131343791-131343813 CAGTGTCCCGAGGCTGTGCAGGG + Intronic
963137796 3:141923404-141923426 CAGAGTCCTGAGGTGGTGCAAGG - Intronic
964154112 3:153564171-153564193 CAGTGTTCCAAGGTTGTGCAGGG - Intergenic
966302666 3:178496653-178496675 CAGTGTCCCAAGGTTGTGCACGG - Intronic
966550581 3:181199996-181200018 CAGTGTCCCGAGGCTGTGCAGGG + Intergenic
967047986 3:185755194-185755216 CAGCCTCCTGAGGTGGTGCAGGG - Intronic
967115390 3:186332954-186332976 TAGAGTCCCAAGGTGGTACAGGG - Intronic
967144282 3:186593044-186593066 CAGACTCCCCAGATGGTGCAGGG - Intronic
967559458 3:190901373-190901395 CTGTGTCCCAAGGCTGTGCAGGG - Intergenic
967805931 3:193714760-193714782 TAGTGTCCCAAGGTTGTGCAGGG - Intergenic
968787287 4:2632117-2632139 CAGAGTCCAAAGGTGGTACAGGG + Intronic
969266305 4:6066337-6066359 CAGTTTCTGAAGGTGCTGCAAGG + Intronic
969483509 4:7459187-7459209 CAGCGTCCCATGGTGGGGCAGGG - Intronic
970976299 4:22046718-22046740 CAGAGTCCCAAGGTGGCACAGGG - Intergenic
972688920 4:41377745-41377767 CAGAATCCCAAGATGTTGCGGGG + Intronic
973131568 4:46654188-46654210 CAATGTCCCAAGGCTGTGCAGGG + Intergenic
973313932 4:48739945-48739967 AAGTGTCCCAAGGTGGTGCAGGG - Intronic
973614216 4:52663018-52663040 CAGTGTCCCAAGGCTGTGCAAGG - Intergenic
974625918 4:64429074-64429096 CAGTGTCCCAAGGTTATACAGGG - Intergenic
975435306 4:74344444-74344466 CAGCTTCCTAAGGTGTTGCAAGG + Intergenic
975506550 4:75144564-75144586 CAGTGTCCCAAGATTGTGCAGGG + Intergenic
976141952 4:82002208-82002230 CAGTATCCTGAGGTTGTGCAGGG - Intronic
979180550 4:117721436-117721458 CACTGTCCTAAGGTTGTGCAGGG - Intergenic
980065723 4:128186821-128186843 CAGTTTCCCAAGGTTGCACAGGG - Intronic
981240098 4:142466805-142466827 CAATATCCCAAGGCGGATCAGGG - Intronic
981391514 4:144196757-144196779 CAGTGTCCTGAGGTTGTGCAGGG - Intergenic
981634101 4:146855177-146855199 CAGTCTCCCAAAGTGCTGCTGGG - Intronic
981699827 4:147596233-147596255 CAGAGTCTCAAGGTGGTGCAGGG - Intergenic
982162864 4:152587339-152587361 CAGTGTCCCAAGGTTGCACAGGG - Intergenic
982189068 4:152834960-152834982 CAGTGTCCCAAGGTTGCACAGGG + Intronic
982390935 4:154863107-154863129 CAGCCTCCCAAGGTGGTGCAGGG + Intergenic
982665597 4:158258174-158258196 TAGTATCCCAAGTTGCTTCAAGG + Intergenic
983469335 4:168137093-168137115 CAGTGTCCCACAGTTGTGCAGGG + Intronic
983665460 4:170176901-170176923 CATTGTCCCAAAGTTGTGCAGGG - Intergenic
985368619 4:189260944-189260966 CAGTGTCCCAAGGTTGCACAGGG + Intergenic
986281871 5:6330158-6330180 CAGTGTCCTGAGGTTGTGCAGGG - Intergenic
986916321 5:12625023-12625045 CAGTGTCCCCAGGGTGTGCAGGG - Intergenic
986949964 5:13071081-13071103 CAGTGTCTCAAGGTTGTGCAGGG + Intergenic
987289527 5:16495484-16495506 CAGTGTCCCAAGGCTGTTCAGGG - Intronic
988456159 5:31388883-31388905 CAGTGTCCCAAAGCTGTGCAGGG + Intergenic
988720093 5:33869157-33869179 CAGTGTCCCAAGGTTGCACAGGG - Intronic
988745612 5:34133485-34133507 CAGTACCCCAAAGTGCTGCGGGG + Intergenic
988788270 5:34584116-34584138 CAAAGTCCCAAGGTGGTGCAGGG + Intergenic
988927844 5:36007131-36007153 CAGTGTCCCAAGGTTGCGCAGGG + Intergenic
989768349 5:45113061-45113083 CAGTATCACAAGCTGGTAAAGGG - Intergenic
990267299 5:54091498-54091520 CAGTAAGCAAAGGTGGGGCATGG + Intronic
990339963 5:54812773-54812795 CAGAATTCCAAGGCAGTGCAGGG - Intergenic
992073337 5:73168876-73168898 CAGTGTCCTAGGGTGATGCAGGG + Intergenic
992478073 5:77123207-77123229 CAGAGTCCCGAGGTGGTGTAGGG + Intergenic
993442919 5:87978578-87978600 CAGTGTCCTGAGGTTGTGCAGGG - Intergenic
993907538 5:93640193-93640215 CAGTCTCCCAAAGTGCTGCTGGG - Intronic
996239045 5:121171581-121171603 CAGTTTCCCCAGGCTGTGCAGGG + Intergenic
996341190 5:122440957-122440979 CAGTGTCCCAGGGTGTTGAAAGG + Intronic
996560672 5:124825684-124825706 CAGAGTCCCCAGGTGGTGCAGGG + Intergenic
997903387 5:137789749-137789771 CAGAGTCCCAAGGTGGCACAGGG + Intergenic
1000005906 5:157184794-157184816 CAGAAGACCAAGGTGGTGCTTGG - Intronic
1001163025 5:169338189-169338211 CAGAGTCCCAAGGTGGAACAGGG + Intergenic
1002392823 5:178929087-178929109 CAGTGTCCCAAGGCTGTGCAGGG + Intronic
1003000202 6:2325041-2325063 CAGTGTCCCAAGGTTGTGCCTGG - Intergenic
1003613797 6:7636920-7636942 CAGAGTCCTGAGGTGGTGCAGGG + Intergenic
1003616421 6:7659045-7659067 CAGTGTCCTGAGGTGGTGCAGGG + Intergenic
1003863548 6:10343502-10343524 CAGAGTCCTGAGGTGGTGCAGGG + Intergenic
1004241687 6:13928835-13928857 TAGTGGCCAAAGGTGGTGCAGGG + Intronic
1004565187 6:16789447-16789469 CAGTGTCCTAAGGCTGTGCAGGG + Intergenic
1004588366 6:17025279-17025301 CATTGTCCCAAGGTGGTGTAGGG - Intergenic
1005563118 6:27061745-27061767 CAGAGTCCTAAGGTGGTGCAGGG + Intergenic
1005908212 6:30284161-30284183 CAGTTTCCTGAGGTTGTGCAGGG + Intergenic
1006250210 6:32777236-32777258 CAGAGTCCCATTGTGGTGCAAGG + Intergenic
1006343924 6:33464619-33464641 CAGAGTCCCAAGGTGATGCAGGG + Intergenic
1007161918 6:39798446-39798468 CAGTATCACAAGGTAGATCAAGG + Intronic
1007305771 6:40903040-40903062 CAGTGTGCCAAGGTGCTGCAGGG - Intergenic
1007430750 6:41775384-41775406 CCCTATCCCAGGGTGGAGCAGGG + Intronic
1007975299 6:46095119-46095141 CAGTATCCCAAGGCTGCACAGGG + Intergenic
1008863930 6:56187162-56187184 CAGAGTCTCAATGTGGTGCAGGG + Intronic
1009059075 6:58375501-58375523 CAGCATCCTGAGGTAGTGCAGGG + Intergenic
1010409696 6:75546869-75546891 CGGAGTCCCAAGGTGGTGCAAGG + Intergenic
1010562046 6:77362604-77362626 CAGCATCCTGAGGTGGTGCAGGG + Intergenic
1010678061 6:78767675-78767697 CAGTGTCCTGAGGTTGTGCAAGG - Intergenic
1011348768 6:86399978-86400000 CCATGTCCCAAGGTTGTGCAGGG + Intergenic
1011707812 6:90020482-90020504 CAGAATCCCAAGGTGGCACAGGG - Intronic
1011847910 6:91589811-91589833 CAGGGTTCCAAGGTGGTGCAGGG - Intergenic
1012753441 6:103192295-103192317 CAGCATCCCAAGGTGACGCAAGG + Intergenic
1012821289 6:104087889-104087911 CAGAGTCCCAAGGTGATACAGGG + Intergenic
1014031029 6:116704623-116704645 CTGTTGCCCAAGGTGGAGCAAGG + Intronic
1016386020 6:143531660-143531682 CAGGGTCCGGAGGTGGTGCAGGG - Intergenic
1016438226 6:144059285-144059307 CAGCTTCCCAGGGTGGTGCAGGG + Intronic
1017931658 6:158960667-158960689 CAGGGTCCCAAGGTGGTGCAGGG + Intergenic
1018621522 6:165733486-165733508 CAGTATGCAAAGGTGTTGTAAGG + Intronic
1018662620 6:166102197-166102219 CAGTGTCCCAAGGCTGTGTAGGG + Intergenic
1019370213 7:659150-659172 AAGAAACACAAGGTGGTGCAGGG - Intronic
1020775628 7:12450750-12450772 CAGTGTCCCAAGGCTGTGCAGGG - Intergenic
1022784733 7:33627132-33627154 CAGTGTCCTGAGGTTGTGCAGGG - Intergenic
1023959061 7:44911959-44911981 CAGGAACCCAAGGAGGTTCAGGG + Intergenic
1024116704 7:46201097-46201119 CAGAGTCCCAAGGTGGCACAGGG + Intergenic
1024729192 7:52235717-52235739 CAGTGTCCTGAGGTTGTGCAGGG - Intergenic
1024963319 7:55001334-55001356 CAGAGTCCCCAGGTGGTGCAGGG - Intergenic
1026129012 7:67605279-67605301 CTGTATCCCAAGGTGGGTGATGG - Intergenic
1026290534 7:69001906-69001928 CAGTATCACAGGCTGGGGCAGGG - Intergenic
1027162502 7:75812982-75813004 CAGCCTCCCAAAGTGGTGCTAGG - Intronic
1027677745 7:81180837-81180859 CAGTATCCCAAGGGTGCGTAGGG - Intronic
1028207206 7:88031795-88031817 CAGTGTCCTGAGGTTGTGCAGGG - Intronic
1028467113 7:91164874-91164896 CAGTATCCCCTGGTGATCCAAGG + Intronic
1028889388 7:95970107-95970129 CTGTATCCAAAGTTGGTCCAAGG + Intronic
1029219203 7:98974523-98974545 CACTGTCCCAAAGAGGTGCAGGG - Intronic
1030834544 7:114265915-114265937 CAGTGTCCTGAGGTTGTGCAGGG + Intronic
1031284149 7:119843060-119843082 CATTATCCCGAGGCTGTGCAGGG - Intergenic
1031360703 7:120845166-120845188 TAGTGTCCCAAGGTTCTGCAGGG + Intronic
1031379990 7:121073887-121073909 CTGTGTCCCAATGTTGTGCATGG - Intronic
1033063482 7:138129696-138129718 CAGGGTCCCAAGGTTGTACAGGG + Intergenic
1034365211 7:150540328-150540350 CAGTGTCCCAAGGCTGTGCATGG + Intergenic
1035180296 7:157084597-157084619 CAGTGTCCCAAGGTTGTGCAAGG - Intergenic
1036749267 8:11433654-11433676 CAGAATGCCAAGGTGGTGAAGGG + Intronic
1037168252 8:15857483-15857505 CAGTCTCCCAAGGTGTTGGAAGG - Intergenic
1037313885 8:17582908-17582930 TAGCATCCCGAGGTGGTGCACGG - Intronic
1037571545 8:20162149-20162171 CAGAGTCCCAAGGTGGTCCTGGG + Intronic
1038448639 8:27623546-27623568 CAGAGTCCCAAGGCAGTGCAGGG + Intergenic
1039877762 8:41602206-41602228 CAGTCTTCCAAAGTGGTGCTGGG + Intronic
1042191672 8:66193423-66193445 CAGTATCACATGGTTGTGAAGGG + Intergenic
1043946017 8:86253446-86253468 CAGAGTCCCAAGGTGGTGTAGGG + Intronic
1044163874 8:88955788-88955810 CAGAGTCCCAAGGTGGCTCAGGG - Intergenic
1044557011 8:93574071-93574093 CAGTATCCCATGGTGTATCATGG + Intergenic
1044945434 8:97384717-97384739 AAGTATCCCAAGGGTGTGCAGGG + Intergenic
1045518130 8:102879137-102879159 CAGTGTCCTGAGGTGGTGCAGGG - Intronic
1046134067 8:110003927-110003949 CAGTGTCCCAAGGCTGTGTAGGG + Intergenic
1046511684 8:115212004-115212026 AAGGGTCCCAAGGTAGTGCAGGG - Intergenic
1046735135 8:117768627-117768649 CAGTGTCCCTAGGTTGTGCAGGG - Intergenic
1046878202 8:119278817-119278839 CAGTGTCCCAAGCCTGTGCAGGG + Intergenic
1048087659 8:131201581-131201603 AAGCATCCCAAGGCTGTGCAGGG - Intergenic
1048096481 8:131300718-131300740 TAGTGTCCCAAGGCTGTGCAGGG + Intergenic
1049090024 8:140507578-140507600 GGGTATCCCAGGGTGGTGCAAGG - Intergenic
1049542681 8:143215595-143215617 CATTCTCCAAAGCTGGTGCAGGG - Intergenic
1050109565 9:2200538-2200560 CAGTATCCTGATGTGGGGCAGGG + Intergenic
1050415141 9:5408813-5408835 CAGTGTCCCAAGGCTGTGCAGGG - Intronic
1050496810 9:6251415-6251437 TAGTATCCAAAGTAGGTGCAAGG + Intronic
1050748747 9:8910551-8910573 CAGAGTCCCAAGGCAGTGCAGGG - Intronic
1051582748 9:18695093-18695115 CATTGTCCCAAGGTTGTGCAGGG + Intronic
1051919817 9:22251606-22251628 CAGTGTCCGAAGGCTGTGCAGGG + Intergenic
1052219934 9:26007870-26007892 CAGAGTCCCAAGGTGGCACAGGG - Intergenic
1053728202 9:41025711-41025733 CAGAGTCCCAAGGTAGTACAGGG - Intergenic
1054931422 9:70639454-70639476 CTGGATCCCAAGAAGGTGCAAGG + Intronic
1055147969 9:72958998-72959020 CAATGTCCCAAGGTAGTGTAGGG + Intronic
1056397263 9:86193330-86193352 CAACTTCCCAGGGTGGTGCAGGG - Intergenic
1056454723 9:86748774-86748796 CAGAGTCCTGAGGTGGTGCAAGG - Intergenic
1056466030 9:86855999-86856021 CAGAATGCCACGGTGATGCATGG - Intergenic
1056560325 9:87724147-87724169 CAGAGGCCCAAGGTGGTGTAGGG - Intergenic
1057208965 9:93189289-93189311 GAGTTTCCCAAGATGGTGCTGGG + Intronic
1057552999 9:96065774-96065796 CAGGGCCCCAGGGTGGTGCAAGG - Intergenic
1057983135 9:99682080-99682102 CAGTGTCCCAAGGTTGTGTAGGG + Intergenic
1058395408 9:104547574-104547596 CAGAGTCCCAAGGTGGTATAGGG + Intergenic
1058447486 9:105066703-105066725 CAATATGCCAAGGTGGCTCACGG + Intergenic
1059604976 9:115824733-115824755 CAGTGTCCCAAGGTTGCACAGGG - Intergenic
1060391332 9:123279769-123279791 AAGATTCCCAAGGTGGTGAAGGG - Intergenic
1203793158 EBV:162265-162287 AAGGAGGCCAAGGTGGTGCATGG - Intergenic
1185963783 X:4576895-4576917 CAGAATCCCGAGGTGGCACAGGG - Intergenic
1186251306 X:7669740-7669762 CAGAATCCCAAGGCGATGCAGGG - Intergenic
1186471061 X:9822520-9822542 CAGTATCCGCATCTGGTGCAGGG + Intronic
1187389943 X:18879274-18879296 CATAATCCCAAGGTGCTGCGGGG + Intergenic
1189127372 X:38462401-38462423 CAGTATCTCAAGGTGGTACAAGG + Intronic
1189213343 X:39303023-39303045 CAGTGTCTCAAGGCTGTGCAGGG - Intergenic
1189421274 X:40860419-40860441 CAGGGTCCCAAGGCAGTGCAAGG + Intergenic
1189431433 X:40950689-40950711 CAGTGTCTCAAGGCTGTGCAGGG + Intergenic
1190144823 X:47880928-47880950 CAGGGTCCTGAGGTGGTGCAGGG + Intronic
1190375190 X:49782396-49782418 CAGAGTCCCCAGGTGATGCAGGG + Intergenic
1190710321 X:53063349-53063371 CAGAGTCCCAAGGTGGCACAGGG + Intronic
1191586645 X:62834190-62834212 CAGCATCCCAAGGTGGCTCAGGG + Intergenic
1191802122 X:65093016-65093038 CAGTGTCCCAAAGCTGTGCAGGG - Intergenic
1191873312 X:65768968-65768990 CAGTGTCCCAAGGCTGAGCAGGG - Intergenic
1191877696 X:65812935-65812957 CAGTGTCCTAAGGTTGTGCAGGG - Intergenic
1193758346 X:85436240-85436262 CAGTGTCCCAAGGTTGCACAGGG - Intergenic
1193770411 X:85581084-85581106 CAGTGTCCCAAGGCTGAGCAGGG + Intergenic
1193865807 X:86728645-86728667 CTGTGTCCCAAGGCTGTGCAGGG - Intronic
1194375541 X:93128308-93128330 CAGTATCCCAAGGCAGCACAAGG - Intergenic
1195035071 X:100965064-100965086 CAGTGTCCCGAGGCTGTGCAGGG - Intergenic
1195715973 X:107819131-107819153 CAGGGTCCCAAGGCTGTGCAGGG - Intergenic
1195814243 X:108867881-108867903 CAGTGTCCCAAGTCTGTGCAGGG + Intergenic
1196317889 X:114250738-114250760 CAGAGTCCTGAGGTGGTGCAGGG - Intergenic
1197524750 X:127547625-127547647 CATTGCCCCAAGGTTGTGCAGGG - Intergenic
1197808092 X:130416404-130416426 CAGTATTCCATGGGGGGGCAGGG - Intergenic
1198181458 X:134213760-134213782 CAGAGTCCCAAGGCAGTGCAGGG - Intergenic
1198269519 X:135042121-135042143 CAGAGTCCCAATATGGTGCAGGG - Intergenic
1198817512 X:140608367-140608389 CAGTGTCCCAAGGCTGTGCAGGG - Intergenic
1199109162 X:143909997-143910019 CAGTGTTCCAAGGTTGTGTAAGG + Intergenic
1199235527 X:145488048-145488070 CAGCATCTTCAGGTGGTGCAGGG + Intergenic
1199421545 X:147650247-147650269 CAGTGTCCTAAGGCTGTGCAGGG - Intergenic
1199445689 X:147918081-147918103 CAGTTTTCCAAGGTGGTGATAGG + Intronic
1200168785 X:154056678-154056700 CAGTAGCCCAAGCAGGTGCAGGG + Intronic
1201947832 Y:19531113-19531135 CAGTGTCCTAAGGCTGTGCAGGG - Intergenic