ID: 952178347

View in Genome Browser
Species Human (GRCh38)
Location 3:30891504-30891526
Sequence CAGAATATGGGCCAGTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 146}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952178347_952178359 19 Left 952178347 3:30891504-30891526 CCAGGTCACTGGCCCATATTCTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 952178359 3:30891546-30891568 GGATTAGGTGTTAGGAGTGTAGG 0: 1
1: 0
2: 1
3: 14
4: 168
952178347_952178355 4 Left 952178347 3:30891504-30891526 CCAGGTCACTGGCCCATATTCTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 952178355 3:30891531-30891553 ATAGGCCAGGGCCAGGGATTAGG 0: 1
1: 1
2: 0
3: 68
4: 340
952178347_952178357 11 Left 952178347 3:30891504-30891526 CCAGGTCACTGGCCCATATTCTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 952178357 3:30891538-30891560 AGGGCCAGGGATTAGGTGTTAGG 0: 1
1: 0
2: 1
3: 19
4: 326
952178347_952178353 -3 Left 952178347 3:30891504-30891526 CCAGGTCACTGGCCCATATTCTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 952178353 3:30891524-30891546 CTGTAACATAGGCCAGGGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 177
952178347_952178351 -9 Left 952178347 3:30891504-30891526 CCAGGTCACTGGCCCATATTCTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 952178351 3:30891518-30891540 CATATTCTGTAACATAGGCCAGG 0: 1
1: 0
2: 2
3: 8
4: 158
952178347_952178363 27 Left 952178347 3:30891504-30891526 CCAGGTCACTGGCCCATATTCTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 952178363 3:30891554-30891576 TGTTAGGAGTGTAGGGGTGCGGG 0: 1
1: 0
2: 0
3: 13
4: 162
952178347_952178362 26 Left 952178347 3:30891504-30891526 CCAGGTCACTGGCCCATATTCTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 952178362 3:30891553-30891575 GTGTTAGGAGTGTAGGGGTGCGG 0: 1
1: 0
2: 1
3: 28
4: 439
952178347_952178352 -8 Left 952178347 3:30891504-30891526 CCAGGTCACTGGCCCATATTCTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 952178352 3:30891519-30891541 ATATTCTGTAACATAGGCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 159
952178347_952178354 -2 Left 952178347 3:30891504-30891526 CCAGGTCACTGGCCCATATTCTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 952178354 3:30891525-30891547 TGTAACATAGGCCAGGGCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 194
952178347_952178361 21 Left 952178347 3:30891504-30891526 CCAGGTCACTGGCCCATATTCTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 952178361 3:30891548-30891570 ATTAGGTGTTAGGAGTGTAGGGG 0: 1
1: 0
2: 0
3: 9
4: 143
952178347_952178360 20 Left 952178347 3:30891504-30891526 CCAGGTCACTGGCCCATATTCTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 952178360 3:30891547-30891569 GATTAGGTGTTAGGAGTGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952178347 Original CRISPR CAGAATATGGGCCAGTGACC TGG (reversed) Intronic
900400077 1:2469435-2469457 GAGCAGATGGGCCAGTGTCCTGG + Intronic
902552794 1:17229260-17229282 CAGAGCTTGAGCCAGTGACCTGG - Intronic
903085486 1:20853804-20853826 CAGAATATGGTAGAGGGACCAGG - Intronic
905164348 1:36068955-36068977 TAGAATATGAGCCAGAGACTTGG + Exonic
905238072 1:36563935-36563957 CAGACTATGGCCAGGTGACCTGG + Intergenic
908558502 1:65281949-65281971 CAGAGTCTGGCCCAGTCACCAGG + Intronic
910459755 1:87436451-87436473 CAGAAGAAGGGCCAGGCACCCGG + Intergenic
913475471 1:119232897-119232919 AAGAATTTGGGGCAGTTACCAGG - Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
918608226 1:186455664-186455686 AAAAATATAGGCCAGTGGCCGGG + Intronic
923429431 1:233905783-233905805 AAGAAGATGGACCAGTGAACGGG - Intronic
924203088 1:241680819-241680841 CAAGAAATGGGCCAGTGAGCTGG - Intronic
924533505 1:244913984-244914006 CAGAATAGAGGCCGGTGGCCGGG + Intergenic
1062854824 10:774718-774740 CAGACTTAGGGCCAGTGCCCAGG - Intergenic
1068968137 10:62934177-62934199 CATGCTATGGGCCAGTGTCCTGG - Intergenic
1070421281 10:76239647-76239669 CAGAATGTGGGTCATTGCCCAGG - Intronic
1070775901 10:79109631-79109653 CAGAATATGGGCGAGTGCATAGG - Intronic
1077283648 11:1756531-1756553 GAGAGTGTGGGGCAGTGACCAGG + Intronic
1077592012 11:3499560-3499582 CAGAAGATGGGCCAGGGGCCAGG + Intergenic
1077916694 11:6616215-6616237 CAGATTATGAGTCAGAGACCAGG + Intronic
1084247852 11:67872292-67872314 CAGAAGATGGGCCAGGGGCCAGG + Intergenic
1084425917 11:69084552-69084574 CAGGAGAGGGGCCTGTGACCAGG + Intronic
1086779626 11:90886443-90886465 CACAAGAAGGGCCATTGACCTGG - Intergenic
1087709269 11:101530601-101530623 CAGAAAATGGGCCTGTTACCAGG - Intronic
1088723966 11:112618359-112618381 GAGAAAATGGGGCAGTGGCCAGG - Intergenic
1092418127 12:8307683-8307705 CAGAAGATGGGCCAGGGGCCAGG + Intergenic
1096845555 12:54404642-54404664 GAGAGTAGGGGTCAGTGACCAGG + Intronic
1098055709 12:66503209-66503231 CAGAAATTGGGCGAGTGAACCGG + Intronic
1098641007 12:72838744-72838766 CAGGATAAGGACCACTGACCTGG + Intergenic
1098880679 12:75914167-75914189 CAGCATATGGGACAGTGATATGG + Intergenic
1100988244 12:100225472-100225494 CAGATTATATGCCAGTAACCGGG - Intronic
1102057369 12:109906839-109906861 CAGAATAAGGCCAGGTGACCAGG + Intronic
1102969918 12:117158204-117158226 CAGAGGATGGTCCAGAGACCTGG - Intronic
1105206754 13:18232283-18232305 CAGAATAAAGGTCAGTGCCCTGG - Intergenic
1106027838 13:25972024-25972046 TAGAATATTTGCCAGTGACTTGG - Intronic
1109881245 13:68480157-68480179 CAGTAGAAGGGCCAGTCACCAGG + Intergenic
1113360193 13:109623365-109623387 GAGAAGATGGGCCAGTGTGCTGG - Intergenic
1114414861 14:22535317-22535339 CAGAATATGGCCCCAGGACCAGG - Intergenic
1115003757 14:28454960-28454982 CAGCCTATGGGCCAGTTACCAGG + Intergenic
1118844519 14:69536878-69536900 CAGTATCTGCTCCAGTGACCTGG - Intergenic
1120245147 14:81997576-81997598 CATAATATGTGCCAATGAGCAGG + Intergenic
1121445093 14:93973751-93973773 CAGAATATGGGTCAGGGGCCTGG - Intronic
1121591679 14:95118403-95118425 CAGAATTTTGGTCAGTGGCCTGG - Intronic
1123082525 14:105702460-105702482 CAGAACATGGCCCAGTGATCAGG + Intergenic
1124338618 15:28875744-28875766 CAGAAGATGGGGCAGGGACTGGG - Intergenic
1124616430 15:31245584-31245606 CAGGGCATGGGCCAGTGACCTGG - Intergenic
1126074796 15:44898798-44898820 CAGAAGGTGGCCCAGTGAGCAGG - Intergenic
1126083573 15:44989017-44989039 CAGAAGGTGGCCCAGTGAGCAGG + Intergenic
1128514901 15:68335928-68335950 CAGAGGATGGGCCAGTGATGGGG + Intronic
1128962971 15:72027900-72027922 CAAAATATGCGCCATTGGCCGGG + Intronic
1129126049 15:73442405-73442427 CAAAATAAGGTCCAGTGACCAGG - Intergenic
1129267260 15:74400378-74400400 CAGAGTCTGCCCCAGTGACCAGG - Intergenic
1130079652 15:80721423-80721445 CCAAATCTGAGCCAGTGACCAGG - Intronic
1132135855 15:99337819-99337841 CAGAACATGGGCCTGTGAGTAGG + Intronic
1132837993 16:1964373-1964395 GAGAAAAGGCGCCAGTGACCAGG + Intronic
1133357489 16:5147288-5147310 CAGAAGATGGGCCAGGGGCCAGG + Intergenic
1136625931 16:31462282-31462304 CAGCATCTGGGGCAGTGGCCAGG - Exonic
1140661422 16:77193798-77193820 CAGAATGGGGGACAGTGACTGGG + Intronic
1141665237 16:85462447-85462469 AAGAAAATGCGCCAGTGCCCAGG + Intergenic
1144733716 17:17543107-17543129 CAGAATGTGGCCGAGTGGCCCGG - Intronic
1146790689 17:35748966-35748988 CAGAATATGGGACTTTGTCCAGG - Intronic
1146790699 17:35749009-35749031 CAGAATATGGGACCTTGCCCAGG - Intronic
1147853487 17:43460236-43460258 CATAATAAGGTCCAGTGAGCAGG + Intergenic
1152582228 17:81171178-81171200 CATAGTCGGGGCCAGTGACCTGG + Intergenic
1154017127 18:10628515-10628537 CAGAGTAAGGGTCAGTGCCCTGG + Intergenic
1154187732 18:12201088-12201110 CAGAGTAAGGGTCAGTGCCCTGG - Intergenic
1154422905 18:14250876-14250898 CTGACCATGGGCCACTGACCAGG - Intergenic
1155093940 18:22537630-22537652 CAGAATTGTGGTCAGTGACCCGG - Intergenic
1157950105 18:52026921-52026943 CACATTATTGGCCAGAGACCTGG - Intergenic
1159467587 18:68804545-68804567 CAGAATGTGGGGCAGCTACCAGG + Intronic
1159934146 18:74348245-74348267 CAGAATATGGGACATTCTCCAGG - Intronic
1160091007 18:75826465-75826487 CAGAAGCTGGGACAGAGACCAGG - Intergenic
1167136416 19:47618825-47618847 CAGAGGATGGCCCAGTGTCCAGG + Intronic
1167208456 19:48118109-48118131 CAGAGAAAGGGCCAGAGACCTGG + Intronic
925817061 2:7763862-7763884 CAGCATGTGGGCCCTTGACCTGG + Intergenic
926008463 2:9390464-9390486 CAGAAGAAGGGCTTGTGACCTGG + Intronic
927902597 2:26831580-26831602 CTGAATATGGACCAGAGACCTGG - Intergenic
928952382 2:36824491-36824513 CAGATCATCTGCCAGTGACCAGG + Intergenic
930575862 2:53147560-53147582 AAAATTATGAGCCAGTGACCTGG - Intergenic
932526576 2:72475920-72475942 CAGCTTAGGTGCCAGTGACCAGG - Intronic
936972908 2:118191920-118191942 CAAAATGTGGTCCAGGGACCGGG + Intergenic
939291258 2:140198063-140198085 TATAATTTAGGCCAGTGACCAGG - Intergenic
939645929 2:144698951-144698973 AAGAATATAGGCCAGGGACCTGG - Intergenic
942544274 2:177046197-177046219 TAGAACATGGGCCACTGAACTGG + Intergenic
943045007 2:182850053-182850075 CACAATATGTGCCAATGACATGG - Intronic
945473656 2:210256236-210256258 CAGAAGATGGACAAGTGAACTGG + Intergenic
946755896 2:222947116-222947138 CAGAATAAGGGACTGTGCCCTGG - Intergenic
947136086 2:226978124-226978146 CAGATTAAGGGCAAGTGACTTGG - Intronic
947327520 2:228994080-228994102 CAGAACATGTGCCAGTGGCCTGG + Intronic
1169794284 20:9444852-9444874 CAAACTATGTGACAGTGACCTGG - Intronic
1173306217 20:41852536-41852558 CAGAATAGGGGCTAGTCACCAGG - Intergenic
1173828446 20:46062535-46062557 CAGAACATGGGCCCCAGACCTGG - Exonic
1174542604 20:51301754-51301776 CAGGAGATGGGCCAGTGCTCAGG - Intergenic
1175768647 20:61608687-61608709 CAGGTGGTGGGCCAGTGACCAGG - Intronic
1179463123 21:41551027-41551049 CAGAGTCTGGGGCAGTGACATGG + Intergenic
1181295824 22:21837859-21837881 CAGACTCTGGGGCAGTGCCCAGG + Intronic
1183030559 22:35100985-35101007 CAGAATATAGGACAGTCAGCAGG + Intergenic
1183037394 22:35150610-35150632 CTGGATTTGTGCCAGTGACCGGG + Intergenic
949821809 3:8123870-8123892 CAGGAGATGGGCCACTGCCCAGG - Intergenic
952178347 3:30891504-30891526 CAGAATATGGGCCAGTGACCTGG - Intronic
952536004 3:34309766-34309788 CAGGATGTGGGCCAGTCACTAGG - Intergenic
955350506 3:58189899-58189921 CAGAGTCTGGGCCAGGGCCCAGG - Intergenic
956443131 3:69299502-69299524 CAGAATCTGGGCCAGGAACGTGG + Intronic
956790868 3:72679069-72679091 CAAAATGTGGTCCAGTGGCCAGG + Intergenic
957062057 3:75490117-75490139 CAGAAGATAGGCCAGTGGCCAGG + Intergenic
960167451 3:114419815-114419837 CATAATAAGGGCCATTGCCCTGG - Intronic
961291341 3:125849284-125849306 CAGAAGATGGGCCAGGGGCCAGG - Intergenic
961794960 3:129402792-129402814 CAGAATCTGGCCAGGTGACCTGG + Intronic
961895830 3:130167064-130167086 CAGAAGATGGGCCAGGGGCCAGG + Intergenic
961958003 3:130824336-130824358 CAGGATATGGGCAGGTGATCTGG - Intergenic
963008223 3:140746121-140746143 CAGAGTATGGGCCAGGGCCAGGG + Intergenic
965276253 3:166686343-166686365 CATGATATGAGCCATTGACCTGG - Intergenic
965482932 3:169242691-169242713 CAGTGTATGGGCCAGTCAGCTGG + Intronic
966121825 3:176529928-176529950 CATACTCTGGGCCAGTAACCAGG + Intergenic
967365623 3:188683264-188683286 CAGACTGTGGGCCATGGACCTGG + Intronic
969005955 4:4020208-4020230 CAGAAGATGGGCTAGAGGCCAGG + Intergenic
969642071 4:8404973-8404995 CACCAAATGGGCCAGTGGCCAGG + Intronic
969721583 4:8895315-8895337 CAGAATGTGGCCCTGAGACCAGG - Intergenic
969746946 4:9080056-9080078 CAGAACATGGGCCAGGGGCCAGG - Intergenic
969806994 4:9617082-9617104 CAGAAGATGGGCTAGAGGCCAGG - Intergenic
970208250 4:13678730-13678752 CAGAACAGGGGTCAGTGAACTGG - Intergenic
970228001 4:13879839-13879861 GAGAATAGGTGCCAGTGAGCTGG + Intergenic
974506150 4:62774841-62774863 CAGAATATTGGCCACTAACAGGG + Intergenic
974575095 4:63708607-63708629 CAGAATATGGGGCTGTGACTTGG - Intergenic
975847207 4:78537438-78537460 CAGAGTATGGTTCAGAGACCTGG + Intronic
977151617 4:93520018-93520040 AACAATATGGGCCAGTGTCATGG + Intronic
979215175 4:118154851-118154873 CTTAATATGAGTCAGTGACCTGG + Intronic
979798514 4:124876865-124876887 CAGAATGTGGGCAAATGATCAGG + Intergenic
981553897 4:145970687-145970709 CAGAATAGGTGCCAGTGCCCTGG - Intergenic
985005733 4:185534017-185534039 CAGAAAATGCTTCAGTGACCTGG - Intronic
986482494 5:8203023-8203045 CAGGAAAGGGGCCAGTGAACTGG - Intergenic
991365764 5:65866426-65866448 CTGGATCAGGGCCAGTGACCAGG - Intronic
997213898 5:132094815-132094837 CAGAATCTGGGCCAGAGGCCAGG + Intergenic
998567157 5:143225893-143225915 CAGAATATGAGCCAATGAGTAGG + Exonic
998628238 5:143869914-143869936 CAGAATGTAGGACACTGACCTGG + Intergenic
1003520123 6:6851191-6851213 GAGAATCTGGGACAGTTACCAGG - Intergenic
1006930923 6:37687951-37687973 CAGAAAAGGGGCCAGTCTCCTGG + Intronic
1009929128 6:70155325-70155347 CAGAATAAGGGCCACTGAGTGGG - Intronic
1010814439 6:80340491-80340513 CAGAATATGGGCTAGAAACGGGG - Intronic
1011635835 6:89372241-89372263 CAGCTTCTGGGCCAGTGAACTGG - Intronic
1014210589 6:118704341-118704363 CAGAAAATGAGCCAGTGGGCAGG - Intronic
1019973217 7:4558978-4559000 CAGAATGTGAGCCACTGCCCCGG - Intergenic
1020326505 7:6978513-6978535 CAGAAGATGGGCCAGGCGCCAGG + Intergenic
1021298654 7:18941989-18942011 GAGAATATGGGCCAGGGACCTGG + Intronic
1030419507 7:109290146-109290168 CATAATGTGGGCCAGTGGCCTGG + Intergenic
1031086415 7:117305832-117305854 CAGCATAAGAGCCAGTGTCCTGG - Intronic
1031441463 7:121799864-121799886 CAGTGTCTGGGCCAGTGCCCAGG - Intergenic
1034481863 7:151327905-151327927 AAGGATATGGGACAGTGACATGG + Intergenic
1036370112 8:8155425-8155447 CAGAAGATAGGCCAGGGGCCAGG - Intergenic
1036880780 8:12510206-12510228 CAGAAGATAGGCCAGGGGCCAGG + Intergenic
1040101540 8:43511253-43511275 CTGACCATGGGCCACTGACCAGG - Intergenic
1041166279 8:55095832-55095854 CAGAGCATGTGCCAGGGACCTGG - Intergenic
1044249525 8:89989562-89989584 GTGAATATGGGCAAGTGACATGG - Intronic
1047160416 8:122371573-122371595 GAGAATATGGGGCAGTGTTCAGG + Intergenic
1048884138 8:138895230-138895252 CAGAATAATGGCCAGTGTCGAGG + Intronic
1050385919 9:5090889-5090911 CAGAATATGGGACTTTCACCAGG - Exonic
1055562661 9:77536064-77536086 CAGAAGCTGGGAGAGTGACCTGG - Intronic
1055920323 9:81453387-81453409 CAGAAAATGAGCTAGTGGCCAGG + Intergenic
1056203182 9:84296036-84296058 AAGAATAGGGGCCACTGCCCTGG + Intronic
1057919819 9:99087855-99087877 CAGAATATGTTCCAGAGACTTGG - Intergenic
1062286630 9:135775961-135775983 CAGAGCAGGGACCAGTGACCTGG + Intronic
1189373372 X:40447315-40447337 CAGGATGAGGGCCAGAGACCTGG + Intergenic
1189865427 X:45322401-45322423 CAGACTATAGGACAGTGACATGG - Intergenic
1190362406 X:49661738-49661760 CAGCATATCGGCCAGTGAGAAGG + Intergenic
1191039961 X:56068463-56068485 CAGAATCAGGGCCACTGAGCAGG - Intergenic
1197121112 X:122894212-122894234 CAGAAAATGTGAGAGTGACCAGG - Intergenic
1198127654 X:133662143-133662165 AAGAGTAAGGGCCAATGACCAGG + Intronic
1198550954 X:137744240-137744262 CAGACTATGTGCCAGAGAGCAGG - Intergenic
1198654395 X:138897824-138897846 CTGAATCTGGACCAGTGCCCAGG - Intronic
1201897008 Y:19002324-19002346 AATACTATGGGCCAGTCACCAGG + Intergenic