ID: 952181067

View in Genome Browser
Species Human (GRCh38)
Location 3:30917315-30917337
Sequence GTGGAACACAAGATATTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952181067_952181075 18 Left 952181067 3:30917315-30917337 CCCCCAAATATCTTGTGTTCCAC No data
Right 952181075 3:30917356-30917378 ACATTTTAATGTCTCAGAAATGG No data
952181067_952181077 20 Left 952181067 3:30917315-30917337 CCCCCAAATATCTTGTGTTCCAC No data
Right 952181077 3:30917358-30917380 ATTTTAATGTCTCAGAAATGGGG No data
952181067_952181076 19 Left 952181067 3:30917315-30917337 CCCCCAAATATCTTGTGTTCCAC No data
Right 952181076 3:30917357-30917379 CATTTTAATGTCTCAGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952181067 Original CRISPR GTGGAACACAAGATATTTGG GGG (reversed) Intergenic
No off target data available for this crispr